All this may point to a clonal process where the reciprocal fusion gene AF4-MLL could be lost during disease progression, as this loss may select for a more aggressive type of leukemia. Therefore, we were interested in unraveling the decisive role of the AF4-MLL fusion protein at an early...
Metastasis is the leading cause of cancer-related death. Despite the recent advancements in cancer treatment, there is currently no approved therapy for metastasis. The present study reveals a potent and selective activity of PRAK in the regulation of tu
Exon 6 of the mouse NF-κB1 (p50) gene, codon TGT for Cys-59 was mutated to GCT encoding Ala-59 by means of site-directed mutagenesis, in which the substitution of p50 reduced DNA binding activity.26,27 This led to the inactivation of NF-κB signal in the transgenic mice. Primers ...
In this study, we aimed to combine transcriptomic and network pharmacology to explore the crucial mRNAs and specific regulatory molecules of Buyang Huanwu Decoction (BYHWD) in intracerebral hemorrhage (ICH) treatment. C57BL/6 mice were randomly divided i
multiple sets of primers and probes are created to detect different regions in Sars-Cov-2. Like other coronaviruses, the Sars-Cov-2 virus has four structural proteins known as the S (spike), E (envelope), M (membrane), and N (nucleocapsid). ...
Figure 1. Auxin-mediated depletion of SPT6 is rapid and specific (A) Schematic of the knockin strategy for AID-tagged SPT6. Shown are components of the knockin cassette. Positions of primers for genomic PCR are marked by arrows. (B)Agarosegel of PCR from U2OSSPT6-AIDknockin clones. wt,...
Abnormal penile foreskin development in hypospadias is the most frequent genital malformation in male children, which has increased dramatically in recent decades. A number of environmental factors have been shown to be associated with hypospadias develo
Glioblastoma (GB) is a highly invasive type of brain cancer exhibiting poor prognosis. As such, its microenvironment plays a crucial role in its progression. Among the brain stromal cells, the microglia were shown to facilitate GB invasion and immunosuppression. However, the reciprocal mechanisms by...
Hybridization probes were generated by PCR from chromosomal DNA of S. Typhimurium C5 using specific primers for the clpP (5’-atgtcatacagcggagaacg and 5’-agattgacccgtatgatgcgc), rpoS (5’- aacgacctggctgaagaaga and 5’- tcgttgagacgaagcatacg) and csrA (5’- atgctgattctgactcgtcg and...
We amplified by PCR a 1528 bp-DNA fragment of the 5' regulatory region of the human Podxl gene comprising 1297 bp from the transcription start site plus 231 bp of 5'-untranslated region, using the primers sense: -1297/-1275 and antisense: 231/208. We started numbering from the ...