Specifically, we have attributed an oncogenic role to circular Pokémon (circPOK) in the context of mesenchymal tumors. circPOK is an EcircRNA generated from theZbtb7agene through back-splicing of exon 2. It pr
All animal experimental protocols were performed in accordance to the NIH Animal Care & Use Committee guidelines. The RARγ knockout mice were generated using the CRISPR/Cas944. Two sgRNAs were designed to target the 1st coding exon (Exon 3) of the mouserarγgene, one (5′-aaggagagactctttg...
Variant rs1990172 is located within an intronic region of the MACC1 gene (Figure 1) and does not affect any splice site of a coding exon. Therefore, it is unclear, if rs1990172 is the causative SNP responsible for the observed effects. Notably, the variant is in strong linkage ...
With the goal of identifying genes that might be utilized as therapeutic biomarkers, we selected genes that exhibited altered expression in C9ORF72 iPSNs, fibroblasts, or human motor cortex via exon microarray. We specifically selected genes coding for proteins that are expressed in the CNS and pr...
Using the distal splice site (AAG) would remove AAG as part of the exon 4, thus resulting in the loss of Arg68 after translation. Figure 1 Alternative splicing patterns and expressions of human Atg8 homologs. A. Schematic diagram of the alternative splicing patterns of LC3B, GABARAP and ...
To generate the Mettl3+/− mice, 2 specific single-guide RNAs (sgRNAs) targeting exon 2 of Mettl3 were used, which resulted in a frameshift mutation and generated a premature stop codon. The animals were maintained on a C57BL/6 background. Mice of 7–8 weeks old were injected intraper...
Scn1atm1Keamice with deletion of the first coding exon, were generated by homologous recombination in TL1 ES cells as previously described (Miller et al.2014). This line has been maintained by continual backcrossing of heterozygotes (abbreviated asScn1a+/−) to 129S6/SvEvTac inbred mice (...
The software “Finding 5′, internal and 3′ coding exons” (http://linux.softberry.com/cgi-bin/progrmas/gfind/fex.pl) was applied to predict exon–intron boundaries. The full-length gene sequence was also compared with the full-length gene sequences of other species using ClustalW2 to ...
Exon 7: 5´ GGGTTCCCTAAGGGTTGGACGTCTTCAGCTGGGGTATTATTCTTTGGGAAGTGATAACGCG/ TCGGAAACCCTTTGATGAGATTGGTGGCCCAGCTTCTAGATTGGATCTTGCTGGCAC 3´ Polymerase chain reaction (PCR) products were separated by capillary electrophoresis on an ABI-3130XL device. The size standard was GeneScan 500–250 (bot...
Further, PVT1 exon 9 overexpression significantly induces castration-resistance in prostate epithelial cells. Consequently, PVT1 exon 9 expression is important for PCa initiation and progression and may have potential diagnostic and therapeutic applications in PCa in Black males.Gargi Pal...