For those with a Spanish subscription, these PDFs will download in English due to the timing of the translations. Subscribers to the Spanish-only product (no English subscription access) will no longer be able to toggle to the English version of the document via the Tools panel. Users will ...
This suggests that USP28 can affect the caspase cascade reaction [42,43,44]. Reports indicate that the overexpression of Noxa in tumors can significantly activate cell apoptosis, initiating the apoptosis process centered around the caspase cascade reaction[18]. In our study, the USP28 inhibitor ...
J Exp Clin Cancer Res 44, 12 (2025). https://doi.org/10.1186/s13046-025-03272-3 Download citation Received07 September 2024 Accepted01 January 2025 Published14 January 2025 DOIhttps://doi.org/10.1186/s13046-025-03272-3 Share this article Anyone you share the following link with will be ...
Of note, Smad3 is known to promote liver fibrosis by directly binding to the promoter regions of collagens upon phosphorylation44,45,46. The USP15LKO mice showed much less intense phosphorylation of SMAD3 in the nucleus (Fig. 8e). We also observed reduced FABP4 and Perilipin1 expression ...
Download: Download full-size image Fig. 4. Ectopic expression of SynUSP.HA at the N-terminus of UL36 cannot rescue in vivo replication and tumorigenesis of vC98A. (A) qPCR analysis of MDV genome copy numbers in whole blood of chickens infected with vRB-1B, vC98A or two independent clone...
Mol. Cell 44, 325–340 (2011) Article CAS Google Scholar Kravtsova-Ivantsiv, Y., Cohen, S. & Ciechanover, A. Modification by single ubiquitin moieties rather than polyubiquitination is sufficient for proteasomal processing of the p105 NF-κB precursor. Adv. Exp. Med. Biol. 691, 95–106 ...
USP21 functions as a negative regulator in antiviral responses through binding and deubiquitinating RIG-1 in the cytosol44. USP21 regulates centrosome- and microtubule-associated functions18,45. Moreover, USP21 affects the transcription of NF-κB p65 through deubiquitinating and stabilizing interleukin-...
USP5 KO mice and their representative WT control mice were maintained in specific-pathogen-free facility. Primers used for genotyping: F: 5′-3′CGCAGCATCAAGCAAGACAGGGG; R: 5′-3′TCAGAGTTAAAACTGGGTAT-GGG. All animal experiments were performed according to the Guideline for the Ethical ...
The tubular sections 42 and 44 have standard open end connections or couplings shown at 42A and 44A. The tubular sections form a passageway through the interiors. In order to support the induction port 40 in the cradle 24, the screws 32A and 32B are backed out, so that the cup members ...