Single-cell analysis revealed high expression of KLRD1 in NK and CD8Tex cells, indicating its critical role in antitumor immune responses. Functional enrichment analyses showed that KLRD1 is involved in several immune-related signaling pathways, including NK cell-mediated cytotoxicity and T cell ...
Homo sapiens killer cell lectin like receptor D1 (KLRD1), transcript variant 1, mRNA DNA编码区: atggcagtgtttaagaccactctgtggaggttaatttctgggaccttagggataatatgc ctttcgttgatgtctacgttgggaattttgttgaaaaattcttttactaaactgagtatt gagccagcatttactccaggacccaacatagaactccagaaagactctgactgctgttct tgccaaga...
KLRD1, also known as Killer Cell Lectin Like Receptor D1, is expressed on the surface of natural killer cells in the innate immune system. KLRD1 functions as a receptor for the recognition of MHC class I HLA-E molecules by NK cells and some cytotoxic T-cells. KLRD1 can create disulfide-...
Influenza challenge studies routinely exclude individuals with existing antibody titers to the challenge strain, meaning the results may not be directly applicable to individuals with existing B cell memory responses [3, 5]. CD4+ T cell and CD8+ T cell cross-reactive memory responses have also ...
Long-term persistence of exhausted CD8 T cells in chronic infection is regulated by MicroRNA-155. Cell Rep. 2018;23(7):2142–56. https://doi.org/10.1016/j.celrep.2018.04.038. Article CAS PubMed PubMed Central Google Scholar Li S, Teegarden A, Bauer EM, et al. Transcription factor ...