In parallel, the lentiCRISPRv2 plasmid, under the control of the EFS promoter, encodes SpCas9 fused to the FLAG tag and a P2A self-cleaving peptide followed by the eGFP marker protein.26 The resultant LV constructs were designated LV/Cas9-sgRNA1-4 or LV/Cas9-sgRNA-Irr. Stable VEGFA-...
D CD5L protein expression in RF24 endothelial cells containing CD5L-overexpressing plasmid versus empty vector (EV). Western blotting was performed two times as technical replicates; in each repeat, the blotting, including loading control, was performed using the same sample processing controls. E ...
B16F10 cells The oligonucleotide containing shRNA candidates for mouse survivin #1,GAAGAACTAACCGTCAGTGAA and #2, CCTACCGAGAACGAGCCTGAT or control shRNA for Luciferase CGCTGAGTACTTCGAAATGTC were prepared as previously described[48]. Post-transfection (48 h), media containing lentivirus were filtere...
Construction of Serpin E1 lentivirus vector and generation of stable cell lines Lentiviral vector expressing Serpin E1-enhanced green fluorescent protein (EGFP, non-fusion) and an EGFP-expressing control vector was constructed by JiKai Gene Company (Shanghai, China). Briefly, the human coding sequence...
Lentivirus particles carrying miR-205 cloned into pGLV2-U6-Puro and packaging plasmid mix were purchased from GenePharma (Shanghai, China). MCF-7/A02 and CALDOX cells were infected with vector control (NC) or miR-205-overexpression virus and selected with puromycin as previously described.23 ...
(ADSCs)areavailable.ThereforeweintendedtoconstructaIentiviraIVEGF165expressionvectorandtheninfecttheADSCstoproducetherapeuticseedcells.MethodsEHS1001.68950485313912clonewasmutatedbyPCRmethodtoproduceconsensusfragmentofVEGF165transcript(NM001025368).LentiviruswasenvelopedwithpGC-FU,pHelper1.0andpHelper2.0plasmidsin293Tcells...
Lentivirus particles carrying miR-205 cloned into pGLV2-U6-Puro and packaging plasmid mix were purchased from GenePharma (Shanghai, China). MCF-7/A02 and CALDOX cells were infected with vector control (NC) or miR-205-overexpression virus and selected with puromycin as previously described.23Plas...
(shRNA) targeting HOOK3 with the si-HOOK-1 sequence. The lentiviruses containing a plasmid that induces the overexpression of VEGFA were acquired from Wuhan Miaoling Biotechnology Company. An empty vector was employed as a negative control. When the cell cultures of AGS, MKN-28, and HGC-27...
A vector encoding the human SRCIN1 open reading frame without the 3′-UTR (EX-Y4423-M68) was obtained from GeneCopoeia (Germantown, MD, USA), and an empty plasmid served as the negative control. The siRNA sequence (5′-AAGCTGTGTCTGTTGAGGCTG-3′) targeting human SRCIN1 was synthesized...
Stable cell lines and plasmid construction Lentiviral vectors containing ShNC (negative control, NC) and ShRNA-SIRT2 (SIRT2-specific target sequence: ShSIRT2#1, 5’-GCCATCTTTGAGATCAGCTAT-3’; ShSIRT2#1, 5’-GCTAAGCTGGATGAAAGAGAA-3’) particles were bought from Shanghai Genechem Co., Ltd...