4.3. Construction of the Strains Resistant to Erm and Spec The erm-resistance cassette was amplified from plasmid pE693, using primers ErmF BamHI (5 TA GGGATCCTTCGTGCTGACTTGCACC 3 ) and ErmR XhoI (5 GTAGCTCGAGAGTAACGTGTAAC TTTCCAAATTTACAAAAG 3 ). The spec-resistance cassette was ...
Expression construction was created by cloning the gel-purified PCR-fragment (~180 bp) into vector pET-32b(+) (Novagen) at the EcoRI and XhoI restriction sites by standard methods [71]. The resulted construct was checked by sequencing. The nucleotide and deduced amino acid sequences were ...
[28] Proteomics FcγRIIB Signaling in B Lymphocytes Oncostatin M Signaling 0.282 0.281 0.375 0.284 3 2.45 [29] [36] PAK Signaling 6.01 [49,50] Phospholipases 0.975 1.56 0.983 3.7 [51,52] RHOA Signaling 0.793 0.45 0.457 8.12 [40,41] Sphingosine-1-Phosphate Signaling 0.475 0.474 4.48 [42...
Design and construction of entry retaining wall along a gob side under hard roof stratum. Int. J. Rock Mech. Min. Sci. 2015, 77, 115–121. [CrossRef] 12. Zhang, Z.; Bai, J.; Chen, Y.; Yan, S. An innovative approach for gob-side entry retaining in highly gassy fully-mechanized...