qBase relative quantification framework and software for management and automated analysis of real-time quantitative PCR data. Genome Biol. 2007;8(2):R19. Article Google Scholar Spiess A-N, Feig C, Ritz C. Highly accurate sigmoidal fitting of real-time PCR data by introducing a parameter for...
The cluster assignment probability (Q) value of 0.50 was used to assign spinach accessions to each subpopulation. The bar plot was drawn using the Q matrices for the optimal K in R version 3.6.3 (R Core Team, Vienna, Austria). The population structure was further confirmed using principal ...
PCR primers used in this study, see Method Details This paper N/A ssODN (5′- to -3′) used as a HDR template:ACCCTTTATCCGAATTTAATGTCACTTGTATGGAATTTGTGCGGTCGGCAAATGCCGCCACTTGTTGTCTGGGGCCCAGGGAACAGATGAACCAAGCTTGACCGCGTTTATAGACGGGTCGGTTATTTACGGGGTGGAGGAAAAGACAGTTGGGGCGCTCCGGACGATGTCAGG...
Primer design and PCR amplification Primer pairs were designed using the Batch Primer 3 software (http://probes.pw.usda.gov/cgi -bin/batchprimer3/batchprimer3.cgi). The parameters for primers design were: (1) primer length from 18 to 28 with 23 as the optimum; (2) P...
The HPLC-MS measurement was performed on a Thermo Scientific Dionex Ultimate 3000 LC system coupled with a Bruker impact HD Q-TOF mass spectrometer. The MS data were acquired in the positive ion mode with a range of 200–2,000 m/z scans with auto MS2 fragmentation. Reversed-phase ...
PCR amplification was performed in 10 μl reactions consisting of 1 μl of template DNA, plus 2.0 mM MgCl2, 0.8 Mm dNTPs, 1 μm of each primer, 1 × NH4 reaction buffer and 0.5 units of Taq (Bioline). Each reaction was amplified using the same PCR protocol of 3 min initial ...
studies and real-time PCR testing were conducted to validate the functional significance of SSR variation.Fifteen single-marker associations from seven PtoCesA genes and nine haplotype-based associations within six genes were identified in the association population (false discovery rate Q 0.05)....
We present a PCR-based D... H.A. Hammond,L Jin,Y Zhong,... - 《American Journal of Human Genetics》 被引量: 1065发表: 1994年 Apparent heterozygote deficiencies observed in DNA typing data and their implications in forensic applications SummaryRestriction fragment length polymorphisms (RFLP) ...
2a). To assess the conformation-dependent Vasa interaction with the ReLo assay, we used Vasa variants with well-characterized point mutations in the ATP-binding pocket that stabilize either the open conformation (K295N; Vasa-open) or the closed conformation (E400Q; Vasa-closed)33,34,35. ...
Real-time PCR analysis of TNF mRNA expression The quantitative real-time PCR amplification was carried out in a total volume of 25.0 μL, containing 2.0 μL 100 × diluted cDNA, 12.5 μL 2 × SYBR Premix Ex Taq (Applied Biosystems, USA), 0.5 μL of each primers...