Primer dimers refer to the unintended interaction between primers that result in the formation of short amplicons with sequence unrelated to any templates. From: Advanced Drug Delivery Reviews, 2016 About this pageSet alert Also in subject areas: Agricultural and Biological Sciences NeuroscienceDiscover...
The major drawback of DNA-binding dyes is their lack of specificity; DNA-binding dyes bind to all dsDNA. As a result, the presence of nonspecific products in a real-time PCR reaction, such as PCR primer-dimers, contributes to the overall fluorescence and reduces the accuracy of quantificat...
fragment amplification efficiency, and detection threshold, and inversely proportional to the formation of primer dimers. Due to their extremely low concentration (and hence, gene copy numbers), the molecular detection of cancer cells in peripheral blood has proven challenging compared to other...
In a 96-plex PCR primer set (192 primers), the fraction of primer dimers decreases from 90.7% in a naively designed primer set to 4.9% in our optimized primer set. Even when scaling to 384-plex (768 primers), the optimized primer set maintains low dimer fraction. In addition to NGS...
45 pairs of gene-specific qPCR primers were experimentally validated by SYBR Green method using first-strand cDNA and ddH2O as template. There were no non-specific amplification and primer-dimers produced by melting curve analysis and agarose gel electrophoresis detection. We used a dilution series...
Self dimers: formed by inter-primer homology between two identical (same sense) primers, when they anneal to each other instead of the template strand. In other words, primer self dimers form when a forward primer anneals to another forward primer, or a reverse primer anneals to another rev...
The 3'-anchored global alignment score is taken to predict the likelihood of PCR-priming primer-dimers, for example 5' ATGCCCTAGCTTCCGGATG 3' ||| ||| 3' AAGTCCTACATTTAGCCTAGT 5' or 5` AGGCTATGGGCCTCGCGA 3' ||| 3' AGCGCTCCGGGTATCGGA 5' The scoring system is as for th...
The final case occurs when the primers interact with each other at the 3' end of either primer to produce primer-dimers (see figure 1C). Figure 1 Primer secondary structure formation. Shown in figure 1A) is the secondary structure stem loop formation for the primer ACATACTGTGAGAAACACAGTA...
High precision is often achieved with PCR; however, sometimes it is necessary to position primers at suboptimal locations in the target. This can result in the formation of primer-dimers and/or undesired amplification of homologous sequences. ...
Figure 2. rhPrimers reduce primer dimers and nonspecific amplification artifacts in multiplex applications. In multiplex PCR amplification of 96 targets from human genomic DNA (NA12878, Coriell Institute), two sets of multiplex primers for the 96 assays (192 individual primers) were synthesized eith...