[1] mRNA sequences, or [2] genomic DNA, but [a] intronless region of genomic sequence non...
Because changes in BCL2 or BAX mRNA expression in the mucosa of CD or UC patients were not observed herein, it could be hypothesized that the transduction pathway leading to apoptosis is mainly an extrinsic one concerning IEC death receptor pathway activation. Moreover, the PGI2 analog iloprost ...
Surprisingly, Box A is able to bind two liver enriched factors, namely HNF1 and HNF3. However, in the context of the intact promoter, as shown by footprinting competition experiments, HNF3 binds solely to this sequence. HNF3, but not HNF1 is a transcriptional activator as demonstrated in ...
By comparing and annotating with the NR database, it is possible to clearly understand which species has significant similarities in gene sequences with the algae species studied in this experiment, as well as to understand some gene functional information of this algae species through the proportion...
The different sources of the mRNA are inverse transcription to the cDNA which is marked with a section of the special source DNA sequence; the marked cDNA mixed in a tube is as the substrate of PCR; it uses a sharing primer and a specific primer to go on the PCR amplification. The ...
Pythium ultimum is a ubiquitous oomycete plant pathogen responsible for a variety of diseases on a broad range of crop and ornamental species. The P. ultimum genome (42.8 Mb) encodes 15,290 genes and has extensive sequence similarity and synteny with rel
mRNA, messenger RNA; NADPH, reduced nicotinamide adenine dinucleotide phosphate; P, postnatal day; PAS, periodic acid–Schiff; PBS, phosphate-buffered saline; PCR, polymerase chain reaction; qPCR, quantitative polymer- ase chain reaction; RET, rearranged during transfection; TBS, Tris- buffered saline...
The primer and probe sequences were: SARS2EF:CGATCTCTTGTAGATCTGTTCT;PROBE:FAM-ACACTAGCCATCCTTACTGCGCTTCG- BHQ-1; SARS2ER: ATATTGCAGCAGTACGCACACA. To generate a standard curve, the cDNA of SARS-CoV-2 E gene sgmRNA was cloned into a pCR2.1-TOPO plasmid. The copy number of sgmRNA ...
ISG15 mRNA was expressed predominately in the villus intestinal epithelial cells in infected piglets (Figure 1F). Abbreviations used in this paper: cDNA, complementary DNA; Ct, cycle threshold; DAPI, 40,6-diamidino-2-phenylindole; FITC, fluores- cein isothiocyanate; GBP, guanylate binding protein...
They work as post-transcriptional regu- lators of gene expression by binding to the 3′-untranslated region (UTR) of target messenger RNAs (mRNAs).3,4 One miRNA can bind to a number of mRNA transcripts, and in turn one mRNA can be targeted by a widespread panel of ...