All mice were kept under specific temperature (18–22 °C), relative humidity (40–70%), and noise (<50 dB) conditions, with ad libitum access to water and food in an animal room with a 12-h light/dark cycle. The mice were randomly assigned to a normal group, an I/R group ...
3D). The specific binding between MATR3 protein and MIDEAS-AS1 was further confirmed by RNA pull down following Western blot (Fig. 3E). Then, we performed RNA immunoprotein (RIP) assay using flag antibodies and revealed that MIDEAS-AS1 was significantly enriched in MATR3 immunoprecipitations ...
RNAs were in vitro transcribed using the T7 RNA Polymerase Kit (Beyotime, Shanghai, China), The gene-specific primers sequences were as following: CCRR (mouse), Forward: GACTGAGCTTTGAAAATATG; Reverse: GTCCCATCCCCAAGCTGCTTGATC. FD (mouse), Forward: GGGAGATAATCACGTTCTGTT; Reverse: TCTGTC...
LUCAT1 was detected by qRT-PCR products with specific primers at sites 2726–2886, and H2O was used as the negative control. The results are shown by nucleic acid gel electrophoresis. (D and E) With JMJD6-knockdown treatment, the expression of Cleaved caspase-3 was assessed (n = 3). ...
Interestingly, the expression pattern and intensity of HSP105 was widely superimposable on that of the proliferation marker Ki67, as detected by the specific monoclonal Ab Mib-1. Lastly, the therapeutic effects of HSP105 functional inhibition was studied in Namalwa BL xenotransplanted SCID mice ...
Recent studies have demonstrated the signaling plasticity of tumor cells in which the blockade of specific targets by anticancer drugs stimulates multiple compensatory signaling molecules and provides an adaptive survival potential to tumor cells, ultimately conferring drug resistance. In this work, we show...
Background: Gene therapy is a therapeutic possibility for retinitis pigmentosa (RP), in which therapeutic transgenes are currently delivered to the retina by adeno-associated viral vectors (AAVs). Although their safety and efficacy have been demonstrated
(list inTable S1). Membranes were then incubated for 1 h with 1:10,000 diluted secondary fluorescent antibodies (LI-COR Bioscience) at room temperature. Specific proteins were detected using Odyssey®Fc (LI-COR Bioscience) after washing. Western blot were analyzed with Image Studio Lite ...
However, the eIF-5A transcript was detectable, suggesting that the silencing effect is rather specific. Moreover, these results were confirmed by Western blot analysis where the 17,75 kDa eIF-5A protein was absent in the transgenic P. berghei ANKA parasites harbouring the eIF-5A-specific ...
while 56 miRNAs were significantly downregulated. In summary, our data demonstrates that there are many distinct EV miRNA expression signatures in ADC and SQCC patients compared to CTRL group, which suggests that there may be certain miRNA candidates that may serve as specific biomarkers for either ...