pEF1_EMCV_ (pSIN.EF1.cPPT.mRFP.IRESEMCV.eGFP.WPRE (Kazadi et al., 2008)) was a gift from A. Telenti (The Institute of Microbiology of the University Hospital Center, Lausanne, Switzerland). pMDL, pVSV-G, and pRSV-Rev helper plasmids for lentivirus packaging were kindly provided by ...
3′ Linker ligation To facilitate cloning, a DNA linker was ligated to the 3′ of the RNA. This linker was synthesised by IDT. It has a blocked 3′ end and an activated adenosine at the 5′ end, with sequence: 5′-rAppTGGAATTCTCGGGTGCCAAGG/ddC/-3′. Ligation was initiated by addin...
and present several common sources of error resulting in miscalls. Availability and implementation: Binaries are freely available for download at http://gmt.genome.wustl.edu/somatic-sniper/current/, implemented in C and supported on Linux and Mac OS X. Contact: delarson@wustl.edu; lding@wustl...
ArticleCASPubMedPubMed CentralGoogle Scholar Levy D, Ronemus M, Yamrom B, Lee YH, Leotta A, Kendall Jet al. Rarede novoand transmitted copy-number variation in autistic spectrum disorders.Neuron2011;70: 886–897. ArticleCASPubMedGoogle Scholar Cook EH Jr, Scherer SW . Copy-number variations...
Elevated APOBEC3B expression in tumours correlates with a kataegic pattern of localised hypermutation. We assessed the cellular phenotypes associated with high-level APOBEC3B expression and the influence of p53 status on these phenotypes using an isogeni
2.2. Characteristics of Primary Melanoma, Disease-Free Interval and Metastatic Disease At melanoma onset, no significant differences were found (Table 2). The median duration of DFI was very similar in the two cohorts, with 15.4 months (range 4–36) for mut/wt and 15 months (range 3–37)...
PPT EDTA-K2 Gel separator tubes (BD Biosciences, Franklin Lakes, NJ, USA). Samples were centrifuged at 4 °C (1800 g) for 10 min. Supernatant was subsequently centrifuged at 4 °C (16,000 g) for 10 min to remove cell debris. cfDNA was isolated from 4 mL of cell-free plasma using...
(EGFR-TKI) were collected upon disease progression. The circulating cell-free DNA (cfDNA) was sequenced using the Oncomine Pan-Cancer Cell-Free Assay™. ExcludingEGFRmutations, the most frequently mutated gene wasTP53(57.3%), followed byAPC(11.3%),FGFR3(7.3%), andKRAS(5.6%). Different ...
DMPPT Control of Photovoltaic Microgrid Based on Improved Sparrow Search Algorithm. IEEE Access 2021, 9, 16623–16629. [Google Scholar] [CrossRef] Ouyang, C.T.; Qiu, Y.X.; Zhu, D.L. Adaptive spiral flying sparrow search algorithm. Sci. Program. 2021, 2021, 6505253. [Google Scholar] ...