Variants in the 5q31 cytokine gene cluster are associated with psoriasis. Genes & Immunity. 2007;9(2):176–81. Article Google Scholar Wang M, et al. Gain-of-function mutation of card14 leads to spontaneous psoriasis-like skin inflammation through enhanced keratinocyte response to IL-17A. ...
In order to address the question of if the role of IL-4 signaling in heart development is evolutionary conserved, we measured the proliferative rate of CMs in the neonatal heart of mice harboring a null mutation of the IL-4 receptor alpha (Il4ra) gene. Immunostaining of the cell proliferati...
ObjectiveTo examine whether single-nucleotide polymorphisms (SNPs) of the interleukin-4 receptor gene IL4R influence susceptibility to, or radiographic progression in, rheumatoid arthritis (RA).MethodsThe contribution of 2 SNPs (I50V and Q551R) in the coding region of IL4R to...
Interestingly, upon repopulation of SCID mice with T cells (independent of IL-4 expression), we found that T cell reconstitution largely reversed the differential gene expression between WT and SCID (Figure 2E). We identified genes involved in positive regulation of synapse plasticity, such as ...
Issue Section: Receptors, Signal Transduction, and Gene © 2006 Society for Leukocyte Biology This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/pages/standard-publication-reuse-rights) You do not...
T helper (Th)2 cytokines such as interleukin (IL)-4 and IL-13 control immune function by acting on leukocytes. They also regulate multiple responses in non-hematopoietic cells. During pregnancy, IL-4 and IL-13 facilitate alveologenesis of mammary glands.
pCR4-TOPO-IL25Addgene NGS results GTTTCGGTGATGACGGTGAAAACCTCTGACACATGCAGCTCCCGGAGACGGTCACAGCTTGTCTGTAAGC GGATGCCGGGAGCAGACAAGCCCGTCAGGGCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCTGGCTTAAC TATGCGGCATCAGAGCAGATTGTACTGAGAGTGCACCATATGCGGTGTGAAATACCGCACAGATGCGTAA ...
142 Aandoeningen van ademhalingsstelsel, mediastinum en thoraxwand 4 Enterogene cyste, zie *Bronchuscyste. Eosinofiel granuloma van de long, zie *Histiocytosis X. Eosinofiele pneumonie (chronische) Zeldzame aandoening, gekenmerkt door persisterende hoest, muco¨ıd sputum, malaise, koorts...
Mutations in the gene encoding pyrin (MEFV) are associated with autoinflammatory disorder Familial Mediterranean Fever (FMF). A "FMF-knock-in" (FMF-KI) mouse strain that expresses chimeric pyrin protein with a V726A mutation (MefvV726A/V... D Sharma,BR Sharma,P Vogel,... - 《American Jo...
SK 3,81/2,8:FORTL.ZAHLEN-Marker card0804109 SZS 0,4X2,5 VDE-Screwdriver1205037 C-SCF 1/2,8X0,8-Connector3240153 C-SCFI 1,5/2,8X0,8-Connector3240049 MC 1,5/ 4-STF-3,81-PCB connector1827729 MCC 1/ 4-STZF-3,81-PCB connector1852383 ...