Methods For this study, 50 patients were randomly assigned to undergo either HPLC ( n = 25) or LPLC ( n = 25) Liver function tests including total bilirubin, gamma-glutamyltransferase (GGT), alkaline phosphatase (ALP), aspartate aminotransferase (AST), and alanine aminotransferase (ALT) were ...
The sequences of the β-actin primers were as follows: 5′ GATGATATCGCCGCGCTCGT and 5′ GGTCATCTTCTCGCGGTTGG. RNA samples were tested for β-actin sequences to verify that each sample was intact and capable of reverse transcription and PCR amplification. The sequences of the globin mRNA ...
Introduction: The atherogenic role of triglycerides (TG) remains controversial. The aim of the present study is to analyze the contribution of TG in the pathogenesis of erectile dysfunction (ED) and to verify the value of elevated TG in predicting major adverse cardiovascular events (MACE). 关键...
Biochemical indicators of liver (TG, TC, FFA, lipase (LPS) activity) function and faecal levels of various lipids (TG, TC, bile acid, and LPS activity) were detected using commercial kits (Nanjing Jiancheng Bioengineering Institute, Nanjing, China). 2.5. Histological analysis of liver tissues ...
Fig. 1: Deletion of HuR in the liver does not alter hepatocyte phenotype of liver function. a Conditional hepatocyte-specific HuR knockout mice (cKO, n = 6) and wild-type littermates (WT, n = 6) were used for analyzing body weight, liver weight, and the ratio of liver/body...
Our data supports the notion that zinc selenium tea has protective effects on liver function in experimental rats, the effects of which are stronger/better than normal green tea. From the point of view of AST activity, a significant reduction in serum AST levels was observed in the ZTHL-...
The function of USP2 depends on C/EBPα/ 11β-HSD1 in fructose-stressed primary hepatocytes. (A) Hypothesis diagram for USP2/ 11β-HSD1 pathway in the liver; (B, C) Relative mRNA expression of C/EBPα (C/ebpα) and 11β-HSD1 (Hsd11b1) in hepatocytes; (D) Protein blotting of...
This study was aimed to investigate the expression of miR-324-5p in GCa, and to analyze its prognostic value and biological function. First, qRT-PCR was used to calculate the expression of miR-324-5p in tumor tissues and cell lines. The prognostic value of miR-324-5p in GCa was evaluate...
In our previous study, γ-glutamyltransferase (GGT) was found to be independently associated with serum FGF21 in Chinese subjects, suggesting that the function of FGF21 is closely related to chronic liver injury [12]. Furthermore, several reports from us and others have demonstrated that serum ...
All subjects were fasted for at least 12 hours prior to blood sampling; complete blood cell counts, aspartate aminotransferase (AST), alanine aminotransferase (ALT), gamma-glutamyl transpeptidase (GGT), total cholesterol, triglyceride (TG), high-density lipoprotein (HDL) cholesterol, fasting ...