Approximately 10 ng of DNA was amplified in a total volume of 10 μL containing 400 nM each of the relevant forward and reverse primer (NPMex12F-TGATGTCTATGAAGTGTTGTGGTTCC, NPMex12R-CTCTGC ATTATAAAAAGGACAGCCAG; or FLT3 ex14F-TGCAGAACTGCCTATT CCTAACTGA; FLT3 ex14R-TTCCATAAGCTGTTGC...
Amplification of BiTE gene from the cDNA using BiTE gene-specific forward PCR primer annealing to signal sequence (5’-GCTGGTCCTGCATCATCCTGTTTCTG-3’) annealing to the signal sequence and reverse PCR primer annealing to the 2A sequence (5’-CCGGGGTTTTCTTCCACGTCTCC-3’). A second nested ...
(GGT)), which were measured photometrically (Clinical Chemistry Analyzer AU700 or AU5800, Beckman Coulter, Brea, CA, USA), and high-sensitivity C-reactive protein (hsCRP) and glycated hemoglobin A1c (HbA1c) using turbidimetric immunoassays (Clinical Chemistry Analyzer AU700 or AU5800, Beckman ...
2.2. OEK-Induced Polymerization Similar to the fabrication of photoresist-based structures, traditional PEGDA microstructure fabrication processes were based on photolithographic technique, meaning that an ultraviolet light source is essential to curing the solution of PEGDA mixed with photoinitiator. A ...
Although mRNA expression and protein analyses may give discordant results, we do not feel that this limits the overall meaning of our results. The absence of systemic effects on RTL in PBMCs and solid tissues and the highly inconsistent mRNA expression pattern of telomerase and shelterins limit ...
IoT systems are resource-constrained systems, meaning they have hardware and power consumption restrictions. Additionally, IoT systems are continuously connected to the internet for data transmission. Thus, IoT systems are vulnerable to security breaches that can compromise the data of the users. ...
Thus far, values ranging from 40% [22] to a maximum of 93%–95% [24] have been reported, meaning that at least 5% continuous phase are required to produce a monodispers emulsion. A recycling step of the oil is possible but difficult to introduce in the downstream preparation. Using ...
However, as the number of parallel computing nodes increases, the data size of each computing node lessens, meaning that the computing nodes would need to switch between processing and communication more often, thereby inevitably resulting in what is known as method call overhead. When the ...