R: CTCCGCAGCAGTTTGGTCAT NM_204524.1 Chicken PPIA F: AGGTGCCCATAACAGCAGAGR: CACCACCCTGACACATGAAG NM_001166326.1 Abbreviations: ACC, acetyl-CoA carboxylase; CPT1A, carnitine palmitoyltransferase 1A; DPP4, dipeptidyl peptidase 4; F, forward primer; FASN, fatty acid synthase; IL1B, interleukin 1...
www.nature.com/scientificreports OPEN High-Intensity Aerobic Exercise Improves Both Hepatic Fat Content and Stiffness in Sedentary Obese received: 22 September 2016 accepted: 18 January 2017 Published: 22 February 2017 Men with Nonalcoholic Fatty Liver Disease Sechang Oh1,2,3,*, Rina So3,4,...
Diabetes mellitus (DM) is associated with higher risk of tendinopathy, which reduces tolerance to exercise and functional activities and affects lifestyle and glycemic control. Expression of tendon-related genes and matrix metabolism in tenocytes are ess
Serum GGT has long been used as a liver function test and a marker of excessive alcohol use; [36, 37] about 35% of women and 87% of men in this cohort were drinkers, with of men with most males drinking to excess [38]. Associations between high GGT and CVD, [31, 32] type-2 ...
Here, we demonstrated that high dietary fructose drives MASLD development and promotes MASLD progression in mice, and identified Usp2 as a fructose-responsive gene in the liver. Elevated USP2 levels were detected in the hepatocytes of MASLD mice; a similar increase was observed following fructose ...
Bifidobacterium bifidum HA-132 HA-132_GB_NC2_F AAGTGTGAGCCGGTGATAGC Noncoding sequence 60 78 HA-132_GB_NC2_R CAGTACGTCGGCCGTTACAT Bifidobacterium breve HA-129 HA-129_225-F2 CGACCCTAATGACGTGGAGG Hypothetical protein 60 195 HA-129_225-R2 CATTTCAGCCAGTACGTGCG Bifidobacterium longum HA-135 ...
(5'–3'): TGTAGACCATGTAGTTGA GGTCA Forward (5'–3'): GGACTTCCTCCCCTGACT CT Reverse (5'–3'): TCGATGCTGACCATTAGA ACACT Forward (5'–3'): CTGCTGCACATTTGTGGC TT Reverse (5'–3'):...
Forward primer: 5′-ACTAGUAAGCAGTGGTATCAACGCAGAG −3′ Reverse primer: 5′-Biotin-ACTAGUCTACACGACGCTCTTCCGATCT-3′ The PCR products were then purified using 0.8 volumes of Agencourt AMPure XP Beads (Beckman Coulter), quantified using Qubit dsDNA HS Assay Kits (Thermo Fisher), and assessed...
(4Ig and 2Ig isoforms) and β-actin were as follows (Supplementary Table6). Human B7-H3-forward: 5’-GTGGTTCTGCCTCACAGGAG-3’; Human B7-H3-reverse: 5’-ACCAGCAGTGCAATGAGACA-3’; Human β-actin-forward: 5’-CACCAACTGGGACGACAT-3’; Human β-actin- reverse: 5’-ACAGCCTGGATAGCA...
In an embodiment of the invention, the cancer is colorectal cancer, lung cancer, skin cancer, breast cancer, brain cancer, stomach cancer, renal cancer, prostate cancer, liver cancer or pancreatic cancer. Thus, the present invention provides methods for treating or preventing an angiogenic eye ...