Mechanistically, ACOT12 and ACOT8 are dramatically upregulated in the liver to convert free fatty acid-derived acetyl-CoA to acetate and CoA. This conversion not only provides a large amount of acetate, which preferentially fuels the brain rather than muscle, but also recycles CoA, ...
Cholesterol synthesis and 3-hydroxy-3-methylglutaryl CoA reductase (HMG-CoA reductase) in the liver of rats at various times (7, 22, 45 and 314 days) after injection with the carcinogen, methylazoxymethanol acetate (MAMA) is reported. Seven days after treatment, an increase in both cholesterol...
Hepatic steatosis is associated with poor cardiometabolic health, with de novo lipogenesis (DNL) contributing to hepatic steatosis and subsequent insulin resistance. Hepatic saturated fatty acids (SFA) may be a marker of DNL and are suggested to be most
(PPP: erythrose-4-phosphate), and high content of intermediates of TCA cycle (acetyl-CoA, citrate, isocitrate, 2-oxoglutarate) and energy metabolism [oxidized nicotinamide adenine dinucleotide (NAD+), reduced nicotinamide adenine dinucleotide (NADH), oxidized nicotinamide adenine dinucleotide phosphate (...
Dietary fructose is converted to acetate by the gut microbiota9, and this supplies lipogenic acetyl-CoA independently of ACLY10. Depletion of the microbiota or silencing of hepatic ACSS2, which generates acetyl-CoA from acetate, potently suppresses the conversion of bolus fructose into hepatic acetyl...
In patients with non-alcoholic fatty liver disease (NAFLD), it has been estimated that as much as 26% of the liver triglyceride derives from DNL (18). The first committed step in lipid synthesis is the conversion of acetyl-CoA to malonyl-CoA, catalyzed by acetyl-CoA carboxylase (ACC). ...
respectively. This study demonstrated that Spirulina enhances liver energy conversion efficiency, detoxification and cellular secretion. It improves hepatic metabolic efficiency through alterations in fatty acid oxidation (e.g., upregulation of enzymes like fatty acid synthase and increased acetyl-CoA levels...
The mature qRT-PCR primer sequence of miR-155 (GenBank Accession no.: NR_029565) was: 5′- UUAAUGCUAAUUGUGAUAGGGGU-3′, while the primer sequence of acetyl-CoA carboxylase-1 (ACC-1) (GenBank Accession no.: AY451393.1) was: forward: GGAGATGTACGCTGACCGAG, reverse: TCACTGCGCCTTCAACT...
ACO Acetyl-coA Oxidase ATGL Adipose Triglyceride Lipase CPT-I. Carnitine Palmityl Transferase-I Keywords Growth fat metabolism hepatic health fat levels largemouth bass 1. Introduction As one of the three primary nutrients, lipids manifestly hold critical importance as nutrients for animal growth, physi...
The induction of Suclg2, a key regulatory enzyme of the TCA cycle, also suggested an enhanced oxidation of acetyl-CoA. Taken together, the data from the hepatic transcriptome profile supported the hypotriglyceridemic effects of linalool. Plasma metabolome analysis also suggested the hypotriglyceride...