"A reliable ally for streamlined translation workflows" What do you like best about memoQ? In my organisation the use of memoQ is not daily, so I appreciate the easy access to the platform. memoQ has an intuitive and user friendly layout making navigation straightforward, meaning that I can...
It is a shame the solution doesn't work with iPhone, although I understand the App Store ecosystem is a challenge. Google Plus Codes are also not supported in the front-end for ODK Collect, meaning we have to come up with a back-end solution to transfrom GPS coordinates to Plus Codes,...
For example, the QGRS GGGACGTTCGGATTGGGTTACCAGGG would be considered (only for the purposes of the tetrad similarity computation) to have a tetrad length of 2.75 - as three of the four tracts have an adjacent extra guanine, meaning that a single mutation in the other tract would have ...
so is the timeless endlessly repeated. When l repeat: ‘I am, I am’, I merely assert and re-assert an ever-present fact. You get tired of my words because you do not see the living truth behind them. Contact it and you will find the full meaning of words and of silence — ...
rid=READER_ID&url=CANONICAL_URL&ref=DOCUMENT_REFERRER&type=ENTRY_TRANSLATE&v1=english&v2=awe&v3=&v4=english&_=RANDOM", name: "pbjs-unifiedid", "authorizationTimeout": 10000 Amidst a balanced life of Ora et Labora in the monastery, the natural splendor and endless glory of the golden ...
Do segmentation in a video with the DINO model Use Paint Transformer to make paintings from a given picture Or you can just explore any of the over 100 existing Spaces! Share Some Love You can now like any model, dataset, or Space on http://huggingface.co, meaning you can s...
"A reliable ally for streamlined translation workflows" What do you like best about memoQ? In my organisation the use of memoQ is not daily, so I appreciate the easy access to the platform. memoQ has an intuitive and user friendly layout making navigation straightforward, meaning that I can...
"A reliable ally for streamlined translation workflows" What do you like best about memoQ? In my organisation the use of memoQ is not daily, so I appreciate the easy access to the platform. memoQ has an intuitive and user friendly layout making navigation straightforward, meaning that I can...
In my organisation the use of memoQ is not daily, so I appreciate the easy access to the platform. memoQ has an intuitive and user friendly layout making navigation straightforward, meaning that I can jump right into my tasks without wasting time figuring how it works. The translation memor...
In my organisation the use of memoQ is not daily, so I appreciate the easy access to the platform. memoQ has an intuitive and user friendly layout making navigation straightforward, meaning that I can jump right into my tasks without wasting time figuring how it works. The translation memor...