Describe the control mechanism of cellular respiration as it pertains to the Krebs cycle? Explain the role of enzymes in cellular respiration. Briefly explain the function of the mitochondrion. Explain the TCA cycle and the electron transport chain. Explain the process of cellular respiration. In wh...
Krebs Cycle/TCA cycle 1. What are the reactants? 2. What are the products? 3. What is the net ATP gain? 4. Where does it take place in prokaryotes vs eukaryotes? Summarize the process/ steps of photosynthesis and cellular respiration. ...
2. Such divergences between males and females are the results of sexual selection for traits that influence individual fitness during the evolution process3. Selective pressure may lead to sexual antagonism, in which traits are beneficial to one sex but harmful to another4,...
3). The pools of labelled and unlabelled cytoplasmic pyruvate are mainly produced via glycolysis and glutaminolysis, respectively, and are consumed proportionally via the TCA cycle. The balance is accumulated reversibly as extracellular pyruvate and lactate. The aim is to estimate the exchange fluxes ...
whereas PFT exhibits little specificity for the terminal amino acid of the CaaX motif, PGGT1 exclusively prenylates CaaX proteins with a leucine in the terminal position. Moreover, we found that different substrates exhibit similar Kmbut different kcatvalues in the presence of PFT and PGGT1, indi...
NCERT solutions for CBSE and other state boards is a key requirement for students. Doubtnut helps with homework, doubts and solutions to all the questions. It has helped students get under AIR 100 in NEET & IIT JEE. Get PDF and video solutions of IIT-JEE Mains & Advanced previous year pap...
KEGG and Hallmark analysis of the 276 proteins revealed endocytosis, apoptosis, EMT and pathways related to focal adhesion and ECM. Activated biochemical pathways included glycolysis, hypoxia, oxidative phosphorylation, TCA cycle and fatty and amino acid metabolism, i.e. metabolic processes induced durin...
TCAATGCCACCTTAATGC ex8R GGAAAGGGTTTTGCATGCC ex10F GTGCCGGTAATGGCAACTTG Plasmid DNA, purified on miniprep Spun Columns (Pharmacia Biotech,Sweden), or PCR products, purified on a MicroSpin S400 HR column (PharmaciaBiotech, Sweden), were sequenced according to the dideoxy chain terminatingmethod (19...
Glycolysis is the process of breaking glucose down into energy to be used by the body. Explore the two steps in this metabolic process and learn about the citric acid cycle, also known as the Krebs cycle, which also breaks down molecules for energy. Related...
Describe 3 major regulatory steps of the TCA cycle. Explain how cancer develops when cell cycle regulation is disrupted. Explain the gram staining procedure and list the required reagents for each step. Explain how the process of atrophy could be accomplished. ...