3. Draw a labelled diagram to show how four nucleotides are joined together to form a double-stranded DNA molecule with two base pairs. [3 marks] 4. State two differences between RNA and DNA nucleotides. [2 marks] Reference: Clegg, C. Biology for the IB Diploma (2nd ed.). Hodder Educ...
Z-DNA antibody (Z22) (AbsoluteAntibody cat. no. Ab00783-3.0) was used to detect Z-DNA by shifting the Z-DNA structure in EMSA gels using FAM-labelled double-stranded linear probes (CACG)8, and Rps6kl1. 0.5 pmoles of probe was induced by hexamine CoCl3 at 100 µM, 200 ...
Fig. 2.Mechanical properties of ss- and ds- DNA. (A) Diagram of a mechanical denaturalization experiment of dsDNA with optical tweezers. A single DNA molecule is tethered to functionalized polystyrene microspheres (beads) using biotin and digoxigenin moieties at the distal ends of one strand (blu...
Signal transducing adapter molecule 2 TCF: T cell factor CLOCK: Clock circadian regulator MAPK: Mitogen-activated protein kinase MSTR1 : Macrophage-stimulating protein receptor GNG7 : Guanine nucleotide-binding protein subunit gamma-7 DAP-1: Disks large-associated protein 1 GKAP: Guanylate...
A small molecule that binds a variety of G4 DNA target structures in cells could be functionalized to allow mapping of G4-interacting proteins in their native environment with minimal perturbation (Fig.1b). We based our probe design on pyridostatin (PDS), a highly G4-selective small-molecule...
Since Z-DNA is a left-handed helix, its appearance in part of a DNA molecule helps to remove supercoiling stress. As negative supercoiling increases, the tendency for GC- or GT-rich tracts of DNA to take the Z-form increases. Its existence can be demonstrated in small plasmids by changes...
In DNA origami, a nanostructure is assembled from a very long single-stranded scaffold molecule held in place by many short single-stranded staple oligonucleotides. Only the bacteriophage-derived scaffold molecules are amenable to scalable and efficient mass production23; the shorter staple strands are...
Each TdT molecule is conjugated to a single deoxyribonucleoside triphosphate (dNTP) molecule that it can incorporate into a primer. After incorporation of the tethered dNTP, the 3′ end of the primer remains covalently bound to TdT and is inaccessible to other TdT–dNTP molecules. Cleaving the ...
3. A nucleic acid molecule of claim 1 which is mRNA or cRNA. 4. A vector which comprises the DNA of claim 1. 5. A host cell transformed with the vector of claim 4. 6. A host cell of claim 5 which does not express other β adrenergic receptors. 7. A method of preparing ...
(ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:3: GTTAACACCCTGGGTCAAAAATTGATATTTAGTAAAATTAGTTGCACTTTGTGCATTTTT60 TCA TAAGATGAGTCATATGTTTTAAATTGTAGTAATGAAAAACAGTATTATATCATAATG120 AATTGGTATCTTAATAAAAGAGATGGAGGTAACTTATGGATAACAATCCGAACATCAATG180 AATGCATTCCTTATAATTGTTTAAG...