Complex synthetic lethality in cancerThis Perspective article explores complex synthetic lethal relationships in cancer, which can involve several partners. Understanding this complexity presents challenges and opportunities for the development of therapeutics that target these interactions.Colm J.,Ryan...
摘要: This Perspective article explores complex synthetic lethal relationships in cancer, which can involve several partners. Understanding this complexity presents challenges and opportunities for the development of therapeutics that target these interactions....
ATP-dependent chromatin remodelers are commonly mutated in human cancer. Mammalian SWI/SNF complexes comprise three conserved multisubunit chromatin remodelers (cBAF, ncBAF and PBAF) that share the BRG1 (also known as SMARCA4) subunit responsible for the
Although chemotherapy remains widely used in cancer care, combinations and targeted approaches are starting to redefine the treatment of some tumors. Engine Biosciences’ network biology approach is well suited to the identification of drug combinations and gene combinations that enable synthetic lethality,...
Moberg KH, Bell DW, Wahrer DC, Haber DA, Hariharan IK: Archipelago regulates Cyclin E levels in Drosophila and is mutated in human cancer cell lines. Nature. 2001, 413: 311-316. 10.1038/35095068. Article CAS PubMed Google Scholar Dealy MJ, Nguyen KV, Lo J, Gstaiger M, Krek W, El...
As oncogenes can generate secondary dependencies, targeting of these vulnerabilities may result in synthetic lethality that is oncogene specific. Our studies uncover a selective dependency of KMT2A-rearranged (KMT2A-r) leukemias on proteostasis and specifically immunoproteasome function. This interferon-...
The PcG proteins have been implicated in a wide range of biological processes, and their significance in cancer research is becoming increasingly evident. Among the PcG proteins, EZH2 is a key player as one of the three core subunits of the PRC2. Multiple studies have suggested that EZH2 mutat...
Although chemotherapy remains widely used in cancer care, combinations and targeted approaches are starting to redefine the treatment of some tumors. Engine Biosciences’ network biology approach is well suited to the identification of drug combinations and gene combinations that enable synthetic lethality,...
Co-targeting SMYD3/PARP leads to synthetic lethality in HR-proficient cancer cells [36]. However, whether SMYD3-2-forward: GCCGTGACCCCGCTG; SMYD3-2-reverse: CATCAGCTTTTCCTTCCCGA; GAPDH-forward: TCCTGTTCGACAGTCAGCCGCA; GAPDH-reverse: ACCAGGCGCCCAATACGACCA. SMYD3 is involved in NHEJ ...
(Inset) Publications with the indicated search terms in the NCBI PubMed database show a significant increase of exosome publications in the cancer (blue), immune (white), and more recently cardiovascular (gray) research fields; while the eye research field (green) is trailing far behind with ...