Excitation power was 30–110 mW as measured under the microscope objective and controlled via a Pockel cell (Conoptics Inc, Danbury CT, USA,). An Ultima II scanhead (Bruker Corporation, Milan, Italy) equipped with 3 mm raster scanning galvanometers (6215H, Cambridge Technology, Bedford,...
Frag- mentation was subsequently performed on all selected precursor masses and the MS2 scan data was acquired in centroid mode. For the method with CID activation MS2 scans were acquired in the linear ion trap following CID fragmentation with normalized collision energy of 30%, Ion Trap MSn AGC...
Fetal haematopoiesis occurs in the bone marrow (BM), once haematopoietic stem cells (HSC) have migrated there from the fetal liver shortly before birth1. In the BM and its surrounding microenvironment (BMM) HSC are regulated by cellular and acellular components2. While most attention, so far, ...
To compare the relative abundances of target gene transcripts, the average threshold cycle (Ct) was normalized to that of Actin (Actin-F: ACTGCACGTTCCAGACGATC; Actin-R: CCACCACCTTGATCTTCATG) for each of the treated samples as 2−ΔCt, where −ΔCt = (Ct, target gene − Ct, ...
printAedcc boirodaicntgivteo CthSe/PreCsLu lstcsaofffothldesp brye vuitoiuliszisntugd eyxt[r3u5s]i,owne‐bdaesveedl oapdeddittivhere me-adnimufeancstiuorninalg( t3eDch) nporilnotgeyd, bthiouasc ativvoeidCiSn/gP tCheL usscea fofof ladnsyb...
Each analysis consisted of a wide survey scan (pass energy 100 eV, 1.0 eV step size) and a high-resolution scan (pass energy 30 eV, 0.1 eV step size) for component speciation. The takeoff angle was 90◦ in all measurements. The binding energies of the peaks were determined using the ...
Lawrence, G.B.; Scanga, S.E.; Sabo, R.D. Recovery of soils from acidic deposition may exacerbate nitrogen export from forested watersheds. JGR Biogeosciences 2020, 125, e2019JG005036. [CrossRef] 32. Driscoll, C.T.; Driscoll, K.M.; Fakhraei, H.; Civerolo, K. Long-term temporal...
119 91.2 161 92.5 44.7 PP–40AII–ZnDA 126 93.2 164 99.9 48.3 Abbreviations: DSC cooling scan: crystallization temperature (Tc) and enthalpy of crystallization (∆Hc); second DSC heating: peak of melting temperature (Tm); enthalpy of fusion (∆Hm), and final degree of crystallinity (χ...
In this way, the reciprocal space scan necessary to collect the diffraction pattern, is carried out electronically, rather than mechanically, as in the conventional Angular Dispersive X-ray Diffraction method. Diffraction patterns, collected in this way, represent the diffracted intensity (n˝ of ...