Cell Mol Life Sci. 2022;79:460. Article PubMed PubMed Central CAS Google Scholar Yu Z, Li D, Sun H. Herba Origani alleviated DSS-induced ulcerative colitis in mice through remolding gut microbiota to regulate bile acid and short-chain fatty acid metabolisms. Biomed Pharmacother. 2023;161...
Subsequently, the targeting efficiency of DiR-labelled URB to the tumor was determined by fluorescence microscope. As showed in Fig. 4d, the red fluorescence signal, which represents the distribution of DiR-labelled live URB, mainly appeared in the tumor tissues but not in the heart, kidney and...
we used fluorescence-activated cell sorting (FACS) and microscopy to accurately classify large numbers of spores for their colonization status with fluorescently labelled bacteria. This analysis confirmed the stable inheritance of the implanted bacteria in spores. ...
d, Cell metabolic cartoon constructed from the annotation of the Ca. N. inopinata genome. Enzyme complexes of the electron transport chain are labelled by Roman numerals. Extended Data Figure 2 Sequence composition-independent binning of the metagenome scaffolds from the nitrifying enrichment cultures....
investigated the effect of abiotic stress (too much or too little water) and biotic stress (infection with lettuce mosaic virus) in growing lettuce. Using green fluorescence protein-labelledSalmonella entericaserovar Typhimurium, they contaminated the leaf surfaces of the growing plants then examined ...
Can you identify the cell envelope (cell wall, which has 4 layers in this type of bacterium, which is called the Gram negative type), the ribosome-rich peripheral cytoplasm and the central DNA-rich nucleoplasm?Click here to see a labelled version of this diagram for the answers! Notice ...
Fluorescent dyes, fluorofores, are applied to the physiological state and viability research at the level of the single bacteria cell. DNA intercalators such as diamidino-2-phenylindole (DAPI) are frequently used for the enumeration of the bacteria population in food and plasma membrane integrity ...
MethodsOligonucleotides Empty Cell Empty Cell NamesSequencesExpected amplicon sizeReferences Real-time PCR pUB110_Left-F GCTCTGACCGTAAACATATTGAGA 159 bp This study pUB110_Left-P FAM- AGATGAATGGACTGCTTATAGCGATAAAGTTAAATCAGA -TAMRA pUB110_Left-R TGTGTCGTTTCGCTGGTACT Real-time PCR pUB110_Right-...
In addition, they assimilated a small part of the methane supplied into cell material. Methanol and acetate also occurred as oxidation products in M. barkeri cultures. Acetate was also formed by the "acetate organism," a methane bacterium unable to use methanogenic substrates other than acetate....
(Table3), reflecting a 1.1-fold to 269.2-fold increase in living cell number. MostLactobacillaceaegrew well, whileStreptococcaceaeshowed weaker growth.L. mesenteroidesNCC 2832 revealed strong growth in all plant milks, whereas the other strains showed preferences for specific types of milk. As ...