b-actin b-amyloid plaques b-band cellular b b-boost b-ecr b-et broadband exchan b-glucosidase b-isdn terminal b-te b-nt broadband networ b-scan b b-scan presenfation b b-scanb b-te broadband termin b-top hr b-uni b-uni - b wholesale trade ser b ask client to close b botany...
bimberstair bimetallicactinometer bimetallic article bimetallicbar bimetalliccompensatio bimetalliccorrosion bimetallicplates bimetallic rotor bimetallicspring bimetallicspringcones bimetallic tube bimetallism double st bimetalrelease biminialing tariff bimodaligneousactivit bimodalriftvolcanism bimodalvolcanism bimolecular co...
一、常用的b-actin引物序列 humanactinfctccatcctggcctcgctgt humanactinrgctgtcaccttcaccgttcc productsize:268 rabbitactinragtgcgacgtggacatccg rabbitactinftggctctaacagtccgcctag productsize:295 mouseactinrcgttgacatccgtaaagacc mouseactinfaacagtccgcctagaagcac ...
Full size image Fig. 5 SARS-CoV-2 infection inhibits the early activation of SHIP in B cells. Naive (CD27−) and memory (CD27+) B cells from COVID-19 recovered patients and healthy controls were activated with 10 µg/ml AF546–mB-Fab′–anti-Ig tethered to lipid bilayers at 3...
steatohepatitis (MASH) and hepatocellular carcinoma (HCC) stages by using qRT-PCR or western blotting. β-actin, internal control. Scale bar = 100μm. The number of patients or mice in each group is shown in B and E accordingly. One-way ANOVA was used to determine significance in E...
Full size table Western blot and immunofluorescence procedure Protein extraction and quantification procedure of CRYAB (CST, Shanghai, China), p-IκBα, IκBα, S6K, 4E-BP (Santa Cruz Bio, Santa Cruz, USA), IKKα, IKKβ, p-p65, p65, IKK, p-IKK, Arg-1, TGF-β1, β-actin, and ...
This gene encodes a member of the ankyrin family of proteins that link the integral membrane proteins to the underlying spectrin-actin cytoskeleton. Ankyrins play key roles in activities such as cell motility, activation, proliferation, contact and the maintenance of specialized membrane domains. Most...
Full size image Representative qRT-PCR and WB of expression of three hub signature genes in OS cells A qRT-PCR was performed to investigate the RNA expression levels of EVX1, TERT, and DLX2 genes in human OS cells (143B and HOS) and normal human osteoblasts (hFOB1.19). β-actin was ...
The ΔΔCt calculation method was used to compute relative gene expression compared to β-Actin. Primers for target genes are listed in Table S3. Luciferase reporter assay HEK293T and CHO cells were cultured according to the culture methods. Cell extracts were prepared 48 hours after ...
Taqman quantitative real-time-PCR analysis was carried out as above using specific primers for ERα (ESR1), AR, HIF1AN,β-actin (ACTB) and GAPDH designed by the Universal Probe Library Assay Design Center (Roche Applied Biosciences, Basel, Switzerland). The sequences of the primers were: ...