A pro- cess like this has previously been applied to create a UV/vis absorption spectral database of organic com- pounds for helping drive progress in DSCs, by identifying promising new dye candidates that might be used to achieve high power-conversion efficiencies (PCEs) in these solar cells...
Immunoanalysis. Western blot analysis was conducted by transferring whole-cell lysates to Immobilon-FL, probing with primary antibodies followed by Alexa 680 nm or IRdye800 nm secondary antibodies, then visual- izing by Licor-Odyssey (Biosciences). Primary antibodies consisted of the rabbit ...
R134a R22 R404a R12 R410a High Concentration Fluorescent Oil for Car Air Conditioning Leak Test UV Dye Auto A/C Detection TracerUSD 5.23-9.03/piece Universal Leak Test Adapter Leak Detection Repair Tool for Europe America Asia Car ( Fit for 90% Cars )USD 56.63/piece ...
Silk Screen Printing and Dye Sublimation Printing M.O.Q 1set Terms of Payment L/C, T/T, Western Union, Money Gram Certification ISO9001, CE Delivery Time 25-30days According to Your Quantity Trademark kdgarden Transport Package Carton/Customsized ...
80 Auto Cut Wall Hanging Thermal POS Receipt Printer, Find Details and Price about Printer 80 Printer from 80 Auto Cut Wall Hanging Thermal POS Receipt Printer - Shenzhen Masung Intelligent Equipment Co., Ltd.
Factory 80mm Cheap POS Autocutter Thermal Printer with Cash Drawer, Find Details and Price about Printer Thermal Printer from Factory 80mm Cheap POS Autocutter Thermal Printer with Cash Drawer - Shenzhen Masung Intelligent Equipment Co., Ltd.
integrity sha512-kVscqXk4OCp68SZ0dkgEKVi6/8ij300KBWTJq32P/dYeWTSwK41WyTxalN1eRmA5Z9UU/LX9D7FWSmV9SAYx6g== fast-deep-equal@^3.1.1, fast-deep-equal@^3.1.3: version "3.1.3" resolved "https://registry.npmmirror.com/fast-deep-equal/-/fast-deep-equal-3.1.3.tgz#3a7d56b559d6...
pini reference genome (bp)Fluorescent dyePrimer concentration in multiplex PCR (μM) 1 Pp2 CTGGGTCAAGTCAAATCTCC 260–300 FAM 0.25 GGACCAAATTCGATCATAGG 0.25 CqfSI_AAG13 AGCAGCACAAGCTGAGAATG AAG 104–107 HEX 0.25 CGTTCTCATCCGAATCCATC 0.25 C3225 TTCTCAAGTACTGCGCCGAG CCAG 10 110 ATTO 550...
through a stainless steel mesh. TGCs were harvested by centrifugation at 400 G for 15 min, washed three times in cold Hanks' balanced salt solution, and then adjusted to a concentration of 1 × 107 TGC/200 μl/mouse after determining cell viability by trypan blue dye ...
is the spectral overlap of fluorescent dyes7. This results in the spillover of fluorescence to detectors different from the detector assigned to each dye (in classical flow cytometry). Removing this unwanted spillover, i.e. compensating, is a necessary preliminary step in the data analysis of ...