Polar groups added to MI-319 to pro- duce the structure of MI-219, increased its solubility for better dispersal in aqueous media and resulted in increased biological activity [33]. The relationship be- tween aqueous solubility and activity has also been demonstrated in the development of ...
pini reference genome (bp)Fluorescent dyePrimer concentration in multiplex PCR (μM) 1 Pp2 CTGGGTCAAGTCAAATCTCC 260–300 FAM 0.25 GGACCAAATTCGATCATAGG 0.25 CqfSI_AAG13 AGCAGCACAAGCTGAGAATG AAG 104–107 HEX 0.25 CGTTCTCATCCGAATCCATC 0.25 C3225 TTCTCAAGTACTGCGCCGAG CCAG 10 110 ATTO 550...
CD4+ T cells were enriched using standard negative depletion by MACS (Miltenyi Biotec) on an autoMACS Pro Separator (Milteny Biotec) according to the manufacturer’s instructions. To this end, the following biotinylated antibodies were used: anti-CD8a (53–6.7; eBioscience), anti-CD19 (6D5;...
through a stainless steel mesh. TGCs were harvested by centrifugation at 400 G for 15 min, washed three times in cold Hanks' balanced salt solution, and then adjusted to a concentration of 1 × 107 TGC/200 μl/mouse after determining cell viability by trypan blue dye ...
(clone 15A7) and viability dye Fixable live/dead stain Efluor780; from ThermoFisher Scientific: Rabbit-anti-Goat-A488, Hoechst 33342, DAPI (4’,6-Diamidino-2-Phenylindole, Dihydrochloride), Phalloidin-A568; from Southern Biotech: AP-Goat-anti-Mouse IgG, AP-Goat-anti-Mouse IgG2a, AP-Goat-...
Sequencing reactions were run using Big Dye Terminator mix (Applied Biosystems, Foster City, CA), purified using CleanSeq magnetic beads (Agencourt Biosciences, Beverly, MA), and sequenced by the University of Wisconsin Biotechnology Center (Madison, WI). Sequence assembly and contiguous alignments ...
(eBioscience) according to the manufacturer’s instructions, and stained overnight at 4 °C with Fixable Viability Dye eFluor780 (eBioscience) or the following antibodies: anti-CD4–BV421 (1:200, clone GK1.5), anti-CD24–BV510 (1:400, clone M1/69), anti-CD3–BV570 (1:250, clone...
(A–C) Relative change of the AR target genes PSA (A), TMPRSS2 (B), and PROSTEIN (C) after 16 h of different concentrations of R1881 in LNCaP and C4-2 cells. Values are expressed as x-fold of untreated cells (5% FCSdcc, dotted line) and are displayed as mean ± s.e.m. (...
Sterilized tweezers were carefully taken out and used to smash the plant material, so that the pollen grains were released as evenly as possible into the dye solution [59]. Glass slides were covered, and filter paper was used to remove the dye solution. Pollen fertility was observed and ...
MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. http-equiv="content-type"