Determine the amino acid sequence encoded in the following mRNA sequence: mRNA codons: AUG GGC GGU GUA AUC Determine the protein (amino acid sequence) from the following mRNA: 5' AUGGCUUUCCUAAUAUAACAUAUC 3' Determine the...
a. charged... Question: Which of the following terms describes a tRNA to which an amino acid has been added? a. charged tRNA b. activated tRNA c. stimulated tRNA d. hydrolyzed tRNA tRNA Molecules: Transfer RNA (tRNA)...
The characteristic antigens which can be obtained from it and which can be employed for detecting antibodies against retroviruses which are associated with immunodeficiency diseases are also disclosed, as are the DNA and amino acid sequences of the virus....
The genetic code is made up ofcodons, which are three-letter chains of nucleotides. Each codon codes for one specific amino acid. The code determines the order in which amino acids are added to a polypeptide chain during protein synthesis. Therefore, the genetic code dictates the sequence of ...
Interestingly, the expression level of GM130 in mouse pancreas was age-dependent, which was nicely correlated with the age-associated susceptibility of CVB3-induced acute pancreatitis. Furthermore, interference RNA-mediated knockdown of GM130 significantly reduced CVB3 replication in HeLa cells. Taken ...
Intestinal epithelial cells line the luminal surface to establish the intestinal barrier, where the cells play essential roles in the digestion of food, absorption of nutrients and water, protection from microbial infections, and maintaining symbiotic in
Complementation of ygl8 with the WT DNA sequence of Loc_Os01g73450 led to restoration of the normal phenotype, and transgenic RNA interference plants showed a yellow-green colour. Analysis of the spatial and temporal expression of Ygl8 indicated that it was highly expressed in leaf blades and ...
What is/are the amino acid products when we have an mRNA that is AUGAAAUUU? What is the step in the synthesis of proteins from RNA called, where the genetic message contained in RNA determines the specific amino acid sequenc...
What is the genetic code for protein synthesis? What is the basic structure of DNA? What determines the proteins that DNA will code for? What is type B-DNA? Which structural component is found in DNA but not in RNA? Which parts of an mRNA strand produce proteins?
it (1) first determines the non cross-hybridizing regions within the sequence entry (instead of scanning the sequence to check for oligonucleotide specificity); (2) can computes different oligonucleotide lengths within the same run; and (3) finds the best oligonucleotide as configured by the user...