Which of the following terms means the absence of smell or odor? a. anosmia b. anacusia c. anopia d. none of these Olfactory receptors: Olfactory receptors are those specialized receptors that are present high in the nasal cavity. These receptors are ...
against which the following command is run: cat gnu.py | srgn --titlecase --python 'doc-strings' '(?<!The )GNU ([a-z]+)' '$1: GNU 🐂 is not Unix' The anatomy of that invocation is: --titlecase (an action) will Titlecase Everything Found In Scope --python 'doc-strings'...
GapR is a nucleoid-associated protein required for the cell cycle of Caulobacter cresentus. We have determined new crystal structures of GapR to high resolution. As in a recently published structure, a GapR monomer folds into one long N-terminal α helix and two shorter α helices, and assembl...
Metformin, a type 2 diabetes treatment, improves the cognitive function of aged mice; however, whether the protective effects of metformin on cognitive function in aged mice are associated with the gut microbiome is poorly understood. Although some studies suggest that the gut microbe composition infl...
Retroviruses must integrate their linear viral cDNA into the host genome for a productive infection. Integration is catalysed by the retrovirus-encoded integrase (IN), which forms a tetramer or octamer complex with the viral cDNA long terminal repeat (LT
Bug Report ShardingSphere version is 4.0.0-RC2. my project maven pom have import sharding-jdbc-core and sharding-jdbc-spring-boot-starter. This is my shard config spring.shardingsphere.enabled=true spring.shardingsphere.datasource.names=...
1.A model of an animal comprising at least one surface which has a surface coating composition which is a metamer of a corresponding surface on the animal as perceived by a vision system of the animal, wherein the surface coating composition is not a spectral match for the corresponding surf...
Morpholinos with a random sequence that does not bind to the zebrafish genome (CCTCTTACCTCAGTTACAATTTATA) and with 5 mismatched bases to the her2 morpholino (CTaGAAAaAGAAGaTAAAAaTTTaG; mismatches are displayed by lowercase letters) were used as controls. Microinjection of morpholinos into ...