)Avg Returned RowsAvg Tuples FetchedAvg Tuples ReturnedAvg Physical ReadAvg Logical ReadAvg Tuples AffectedAvg Data IO Time(us)Sort CountSort Time(us)Sort Mem Used(KB)Sort Spill CountSort Spill Size(KB)Hash CountHash Time(us)Hash Mem Used(KB)Hash Spill CountHash Spill Size(KB)SQL Text...
windowtext 1pt solid;" width="181">1280(H)×720(V)处理芯片
Genetics 181(4):1627–1638 Article CAS Google Scholar Li WT, Chern M, Yin JJ, Wang J, Chen XW (2020) Recent advances in broad-spectrum resistance to the rice blast disease. Curr Opin Plant Biol 50:114–120 Article Google Scholar Liu G, Lu G, Zeng L, Wang GL (2002) Two broad...
import"github.com/jaswdr/faker/v2"funcmain() {fake:=faker.New()fake.Person().Name()// Lucy Cechtelarfake.Address().Address()// 426 Jordy Lodgefake.Lorem().Text(100)// Dolores sit sint laboriosam dolorem culpa et autem. Beatae nam sunt fugit// et sit et mollitia sed.// Fuga dese...
For this aim, primers flanking the polymorphism were designed, to amplify a 181 bp fragment (For: 5’- GCCCGAAAAGAACGAGGA -3’, Rev: 5’- ACCCACTACCAAGGACACAGA -3’). Amplifications were performed with Rotor-Gene TM 6000 (Corbett Research, Mortlake, New South Wales, Australia), in ...
181 B5 CHAR(10) Inquiry message reply 191 BF CHAR(13) Device recovery action 204 CC CHAR(10) Time-slice end pool 214 D6 CHAR(15) Accounting code 229 E5 CHAR(80) Routing data 309 135 CHAR(50) Text description 359 167 CHAR(1) Reserved 360 168 BINARY(4) Offset to initial library lis...
J. Cell Biol., 181 (2008), pp. 255-267 CrossrefView in ScopusGoogle Scholar Kanai et al., 2000 Y. Kanai, Y. Okada, Y. Tanaka, A. Harada, S. Terada, N. Hirokawa KIF5C, a novel neuronal kinesin enriched in motor neurons J. Neurosci., 20 (2000), pp. 6374-6384 CrossrefView ...
ImageJ Scripts used in Quidwai, et al., 2020. Contribute to IGC-Advanced-Imaging-Resource/Quidwai2020_WDR35paper development by creating an account on GitHub.