A server provides instructions for each raster image processor which of the plurality of pages to generate ... PA Coniglio,RD Doyle,NA Lee,... - US 被引量: 7发表: 2010年 A combined experimental and theoretical (DFT and AIM) studies on synthesis, molecular structure, spectroscopic properties...
The cytokines were quantified using the Mouse Cytokine Array Pro-inflammatory Focused 10-plex (MDF10; Eve Technologies Corp., Calgary, Alberta, Canada) per manufacturer's instructions. The 10 cytokines that were determined include: granulocyte-macrophage colony-stimulating factor (GM-CSF), interferon-...
HEK239H cells were seeded in 6-well plates (1 × 106 cells per well) and transfected the following day using Lipofectamine 3000 (Invitrogen L3000008) according to the manufacturer’s instructions. 2 μg of p61BRAFV600E plasmid (pcDNA-3 vector) DNA per well was employed. 24 h ...
Batchelor (2013: 49) also points out that the written instructions from Calicut indicate the use of geng on the map. Hsu (1988: 102) has described geng aptly: Gen[g] was a time unit in historic China; one day and night constitute ten gen[g], or one gen[g] equals 2,4 hours. In...
Antibody sequences were obtained using the SMARTer RACE cDNA Amplification Kit (Clontech) according to the manufacturer's instructions. Primers used for reverse transcription were GATTACGCCAAGCTTTATGCAAGGCTTACAACCACA (heavy chain), GATTACGCCAAGCTTCACAATTTTCTTGTCCACCTTGGTGC (heavy chain nested), ...
FIGS. 43 and 44 show various exemplary embodiments of screens of a graphical user interface displaying procedure instructions to a patient; FIGS. 45A-45C and 46A-46E show various exemplary embodiments of screens of a graphical user interface usable to display specific procedure instruction and troubl...
Both external and implanted memory of the devices of system 100 will often be used to store, in a tangible storage media, machine readable instructions or programming in the form of a computer executable code embodying instructions and/or data for implementing the steps described herein. The func...
The term “instructional material” or “instructions” includes a publication, a recording, a diagram, or any other medium of expression which can be used to communicate the usefulness of a subject composition described herein for a method of treatment or a method of making or using a subject...
www.nature.com/scientificreports OPEN Optimization of an O 2‑balanced bioartificial pancreas for type 1 diabetes using statistical design of experiment Anne Mouré1,8, Sawsen Bekir1,8, Elodie Bacou1, Quentin Pruvost1, Karine Haurogné1, Marie Allard1, Laurence De...
standard 48 well plates to compare the viability of PDX cells in 2D and 3D. Cells were incubated at 37 °C, 20% O2, and 5% CO2, and the viability of both 2D and 3D cultured PDX cells assessed using Live/Dead stain (Thermo Fischer Scientific) as per the manufacturer’s instructions. ...