And method of satellite communication system using a feeder link antenna which is disposed in substantially the same positionSatellite communication system is provided with feeder link for a plurality of antennas, the auxiliary satellite and main satellite,. Feeder link antennas are arranged in ...
We introduce a method for creating New Alloys that is faster, simpler, and uses less material than conventional methods. This approach allows researchers to make alloys in just 30 minutes~1 hour through a simplified process and with only a small amount of material, enabling high quality research...
A method was developed to reduce the dye matrix with dithionite so that combined benzidine present in the form of azo or disazo dyes would be converted to free benzidine. Reduction was followed by extraction, diazotization and coupling with pyrazolone T, and the total benzidine present was ...
gapdh2_ F: GAGTTTTCGCCCATAGAAAGC gapdh2_R: CGATGCGACCAAATCCATTG27 Ptc expression was calculated using the ddCt method relative to gapdh2 expression. Microscopy Cells were live-imaged 24 h after stimulation with Hh condition medium. 2–3 h prior to imaging cells were lifted by pipe...
Human pluripotent stem cells (hPSCs) were first reported to have trophoblast differentiation potential in 2002, when hCG-secreting multinucleated trophoblasts were identified in cultures containing feeder conditioned media (FCM) supplemented with bone morphogenetic protein-4 (BMP4)18. Since then, multiple...
FACS isolation of CPMhigh cells is a powerful method for purification of NKX2-1+ lung progenitor cells. Passage of AOs for long-term culture (fibroblast-dependent) AT2-like cells in passaged AOs have more mature alveolar lamellar bodies. Therefore, for the experiments focusing on lamellar ...
Human embryonic stem cells(hESCs)were derived conventionally using immunosurgery method on a mouse embryonic fibroblast(MEF)feeder layer.However,the method... Fatemeh,Akyash,Somayyeh,... 被引量: 0发表: 2017年 Monitoring early differentiation events in human embryonic stem cells by massively parallel...
Method tbb::task::parent() gives you read-only access to the successor pointer. Each task has a ref_count that accounts for the number of tasks that have it as a successor (i.e., the number of children that the parent has to wait for before it can be triggered for execution). And...
Examples of 3D models of enclosed screw feeders are presented along with detailed predictions of their performance, namely: (1) the effect on the mass flow rate of a screw feeder as its angle of inclination was increased; (2) the effect on the mass flow rate of a screw feeder having a ...
A METHOD AND AN APPARATUS FOR SUSPENDING BIRDS FROM AN OVERHEAD CONVEYOR A method for suspending birds from an overhead conveyor, comprises the following sequence of steps: A) each bird is arranged in a holder with its legs and/or feet projecting from a first opening therein and its neck ...