3.2. Phylogenetic analysis of genome bins For phylogenetic analysis four trees were created. ForLc. lactisbin tree construction, 19 genomes ofLc. lactissubsp.lactisstrains and 12Lc. lactissubsp.cremorisstrains were used with one genome ofStreptococcusthermophilusas an outgroup. ForLb. helveticusbin,...
4.3. Construction of the Strains Resistant to Erm and Spec The erm-resistance cassette was amplified from plasmid pE693, using primers ErmF BamHI (5 TA GGGATCCTTCGTGCTGACTTGCACC 3 ) and ErmR XhoI (5 GTAGCTCGAGAGTAACGTGTAAC TTTCCAAATTTACAAAAG 3 ). The spec-resistance cassette was ...
For improving the heat flux uniformity of PV cell C, Tsai developed a free-form concentrator by connecting several circular arc segments together [19]. In the curr5enoft15 study, a similar model is extended for a PV/Thermal hybrid system, named the Curved Geometry Construction Method (CGCM)...