And I thought it was so mind-blowingly awesome, that the writer underlines the importance of facing life's cruel realities head-on, by having our protagonists failing again, and again to end W/cheat fate by taking shortcuts (resetting time to the past) and avoiding conflicts (faking death)...
This custom bottle label was designed for a limited edition private selection of a Single Malt Scotch, the object of which was to be a ten-year-long planned tribute in honor of the client’s daughter’s Bat Mitzvah. The blue and white duotone logo reflects traditional colors of the Jewish...
but also exposure to a variety of information and different opinions. OLs can play a key role in this process, as they are not only connected to numerous users in the network, but also have a strong influence on other users’ opinions. “Generally, opinion leader is obviously...
“extreme vulnerability” [2,p. 19), and the circles around the kneelers suggest that while their respective worldviews may be coming together, the differences between them are also valued. The painting underlines that mutual trust, respect, and an open heart are needed for co-learning and ...
Table 1. Primers used in this work Underlines indicate restriction enzyme cutting sites containing protective bases. GenBankTM accession no.PurposePrimer sequence (5′–3′) AB330446 (BNGR-A25S) Cloning into pCMV-FLAG/pBmIE1-FLAG CCCAAGCTTGGGATGGATACTGGTTCGTTCCTTC CGCGGATCCGCGTTACCTTCCACTCATTAC...
Therefore, the nomination of CC or GW as an issue underlines that it is a topic in which different people might have different viewpoints, while the framing of GW as a problem suggests that it must be solved. The representations of GW thus tend to be more negative than the representations ...
lead to a strengthening of users’ opinions [13] and underlines the important role of OLs in the process of diffusion [14], little is known on the impact of ambivalent opinions conveyed by OLs. Therefore, we aim to compare effects of univalent and ambivalent OLs on the network level and ...
. The colour gradient is proportional to the average abundance of genes and underlines that medium-abundance genes are mostly affected by the variability in fold-change amplitude and identity. We also assessed the stability of the DE signal for the GT and two sets of simulations for ...