Triple AAA Construction - Roofing Contractor Serving Manatee and Sarasota Counties. Specializing in Metal, Tile, Shingle and Flat Re-Roofs and Repairs.
Home Product Directory Construction & Decoration Building Glass Tempered Glass 12mm Tempered Glass FOB Price:US$13.00-15.00/ Square Meter Min. Order:1 Square Meter Port:Qingdao, China Transport Package:Wooden Box Payment Terms:L/C, T/T, D/P ...
Q.1: Are you manufactory or trading company? We are the manufactory specialize in structured cabling network products and accessories. Our factory had been verified by ISO9001:2005, and we are AAA grade credit enterprise. Q.2: Can we pay the visit to your factory? ...
Plasmid construction The shlncRNA–AFAP1-AS1 plasmid of lncRNA–AFAP1-AS1 was constructed to the pcDNA3.1-EGFP vector. Target sequences (shR–AFAP1-AS1-top: 5′- GATCCGTTCTGGGCTTCAATTTACAAGCAGTCAGCTCGAGCTGACTGCTTGTAAATTGAAGCCCAGAACTTTTTGA-3′; shR–AFAP1-AS1-bot: 5′- AGCTTCAAAAAGTTCT...
Q.1: Are you manufactory or trading company? We are the manufactory specialize in structured cabling network products and accessories. Our factory had been verified by ISO9001:2005, and we are AAA grade credit enterprise. Q.2: Can we pay t...
Q.1: Are you manufactory or trading company? We are the manufactory specialize in structured cabling network products and accessories. Our factory had been verified by ISO9001:2005, and we are AAA grade credit enterprise. Q.2: Can we pay...