triplet pregnancyTo the best of our knowledge, we report the first case of a successful antenatal intervention in a double twin reversed arterial perfusion (TRAP) sequence in a monoamniotic monochorial triplet pregnancy. After diagnosis during first-trimester ultrasound, fetoscopic coagulation and ...
Monochorionic Multiple PregnancyThe twin reversed arterial perfusion (TRAP) sequence is an anomaly unique to monochorionic multiple pregnancies. It is a rare complication. We present a case of acardius anephus, which was mistaken for a live anomalous singleton fetus. A 21-year-old unbooked ...
The primers and probes published by WHO were used to detect a region of E gene in the SARS-CoV-2 genome, with sequences (Sangon Biotech) as follows: E_Sarbeco-F, ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-R, ATATTGCAGCAGTACGCACACA; E_Sarbeco-probe, FAM-ACACTAGCCATCCTTACTGCGCTTCG-BH...
We present an unusual case of TRAP sequence (twin reversed arterial perfusion) with persistent polyhydramnios despite spontaneous thrombosis of the vena umbilicalis of the acardius. Serial amnioreduction was performed owing to considerable maternal discomfort and preterm labor. After three procedures, ...
An unstable mRNA signal sequence (ARE) to the 3′end of EGFP was added. The IRES, three ICs and SD were added between EGFP and ARE. There is the option to remove the IRES using Cre, thereby removing the truncated protein (but not GFP). A SA was added in front of EGFP reporter...
Sequence of ejaculation affects the spermatozoon as a carrier and its message Reprod. Biomed. Online (2003) J.J. Bromfield Review: The potential of seminal fluid mediated paternal-maternal communication to optimise pregnancy success Animal (2018) A.R. Chavan et al. The inflammation paradox in th...
The ORAI1 siRNA sequence is 5′GCAACGUGCACAACCUCAATT3′, 5′UUGAGGUUGUGCACGUUGCTT3′. Immunofluorescence for NET Formation Analysis To assess NET formation, neutrophils combined in round coverslips (from 24-well plates) from different groups were fixed with 4% paraformaldehyde for 15 min at 4...
Conclusions The antenatal diagnosis of TRAP-sequence is feasible and can be established during the first-trimester-screening. The discrimination of the adequate time to end the pregnancy, though a crucial concern, remains a challenging question. Future studies should address this topic....
Anca FA, Negru A, Mihart AE, Grigoriu C, Bohiltea RE, Serban A. Spe- cial forms in twin pregnancy--ACARDIAC TWIN: twin reversed arteri- al perfusion (TRAP) sequence. J Med Life 2015;8:517-22.Anca FA, Negru A, Mihart AE, Grigoriy C, Bohilţea RE, Şerban A. Special ...
monochorionic pregnancyintrafetal laserTRAP sequencePurposeTo evaluate the outcome of first trimester intervention by intrafetal laser (IFL) in pregnancies complicated by twin reversed arterial perfusion (TRAP). Materials and MethodsFor a 10-year study period, all patients with TRAP diagnosed <14.0 ...