What are transitional epithelial cells in urine? Transitional Epithelial Cells: Transitional epithelial cells form the protective epithelium that lines the bladder, urethra, and ureters. Their structure allows them to maintain their protective barrier even when the bladder and other urinary structures expan...
The genotyping assay was performed using specific, provided PCR primers (forward primer TGGGACCCACTCCATCGA, reverse primer CATGAAGACCTCACAGTAAAAATAGGTGAT, no canine-specific primers) and probes (the probe sequence for detection of the wild-type allele was TAGCCACAGTGAAATC labelled with VIC™ ...