(a) The presence of the major intestinal cell types where analyzed by qPCR for specific intestinal markers: intestinal stem cells (Lgr5), enterocytes (Villin); Paneth cells (Lysozyme), Goblet cells (Mucin 2) and enteroendocrine cells (Chromogranin A). The mRNA levels of each marker were ...
The primer sequences were described in Table 1. The sequences of the primers were as follows: Table 1. Primer list used for qPCR. Target mRNA IL1-β CCL2 PPARγ aP2 GAPDH Forward Primer (5 →3 ) AATCCCCAGCCCTTTTGTTG TGTCCCAAAGAAGCTGTGATCT TTCCCGCTGACCAAAGCAAA TGCAGCTTCCTTCTCACCT...