The influence of membrane fluidity on the activity of membrane-bound enzymes - Kimelberg - 1977 () Citation Context ...mponents in the plane of the membrane would appear to be particularly valuable in view of the growing appreciation of the functional importance of lipid physical state in ...
The effects of bile acids on β-adrenoceptors, fluidity, and the extent of lipid peroxidation in rat cardiac membranes membrane fluiditylipid peroxidationβ-adrenoceptorsreactive oxygen speciesBile acids have been proposed as a causative factor for the cardiomyopathy of cholestatic... H Gazawi,P Lju...
The heat stress is known to severely affect the membrane fluidity, which causes malfunctioning of intracellular organelles (chloroplast and mitochondria) due to increased cytosolic calcium and reactive oxygen species (ROS)11. The increased ROS seldomly leads to over-reduction of electron transport chain...
TCTGAA TG primers. The expression of the following tomato genes was analyzed using amplicons obtained with the sense and reverse sense primer pairs (5′ to 3′): 180 bp ofβ-actin(TC178617) GGAAAAGCTTGCCTATGTGG/CCTGCAGCTTCCATACC AAT, 66 bp ofHsfA2(CAA47870) ACCTTGTGGATCAGCTTGGT...
As already pointed out in Section 5.3, binding of xanthophylls to antenna proteins is likely to affect the rate of xanthophyll conversion in thylakoid membranes by controlling the release of xanthophylls into the lipid phase of the membrane. While it is generally assumed that most of the VAZ pigm...
The findings indicated that these strains accumulated nucleotide mutations to a threshold level that did not affect the function of specific proteins encoded by the MEL BGC and LipA and LipB genes. The biosurfactant and lipase enzymes secreted by these Trinidad M. antarcticus strains facilitated ...
The phase behaviour, particularly the fluidity within each phase state and the transitions between them, of lipopolysaccharides and of their lipid moiety, free lipid A, of various species of Gram-negative bacteria, especially of Salmonella minnesota and Escherichia coli , has been investigated by appl...
The discovery of new inflammatory pathways and the mechanism of action of inflammatory, autoimmune, genetic, and neoplastic diseases led to the development
As membrane cholesterol plays an integral role in the binding and regulation of many transmembrane proteins62, we asked if and how cholesterol enrichment on graphene substrates could affect transmembrane proteins and the signaling pathways they mediate. Using the same approach that was used for our ne...
In general, tumor metastasis incorporates the following processes. First, before the formation of metastases, primary tumors or CTCs induce PMNs that provide support for the growth and colonization of tumor cells in distant organs. Second, CTCs undergo changes such as EMT to increase invasiveness and...