Democrats who were once bullish that Kamala Harris could expand the map are now worried it’s the Blue Wall or bust for her White House hopes. Donald Trump just won North Carolina, and though the rest of the core battleground states are still too close to ...
Total RNA was extracted and 1 μg was reverse-transcribed (SuperScript III, high GC content protocol; Life Technologies) with gene-specific primers downstream of the splice junctions that would bind both spliced and unspliced transcripts: AF-SS-238 (CTTAGCGACGTAGACCTAGTTTTT, SEQ ID NO: 23) ...
limestone(mapunitL1),sandstone(mapunit S4),andgranite(mapunitG)inCentraland EastTexasprovidebuilding,dimension,and facingstoneforcommercialandresidential structures.Crushedlimestone,sandstone,and otherrockandsedimenttypesfurnishhard-rock aggregatesinroadbases.Rechargesandsalso ...
Briefly stated, the present invention provides compositions and methods for modulating the activity of MAP/ERK kinases such as MEK3, and stress-responsive MAP kinase pathways. Within certain aspects, the present invention provides polypeptide variants of TAO proteins. Within one such aspect, polypeptide...