Kelly Reifel Compass RE Texas, LLC - Houston $850,000 Active 1903 Sutters Chase Dr Sugar Land, TX 77479 For Sale, Single-Family 5 beds 3 baths 4,249 Sqft. ($200/Sqft.) 20 Days on HAR Open House Dec 28 12:00 PM – 2:00 PM Edward Blanchfield RE/MAX Fine Properties $599...
4202 Caroline Ct, Sugar Land, TX 77479 SKW Realty Use arrow keys to navigate $458,500 4bd 3ba 2,089 sqft 3327 Larkwood Ln, Sugar Land, TX 77479 Executive Texas Realty Use arrow keys to navigate 0.25 ACRES $949,000 5bd 4ba 4,234 sqft (on 0.25 acres) 3111 Oakmont Dr, Sugar La...
Texas Fort Bend County Sugar Land Twin Rivers Ct 5602 Twin Rivers Ct View as ownerSeller represented by: Bincy Jacob with Keller Williams Realty -Sw Buyer represented by: Naeem Charolia with Walzel Properties 1/32 Sold on October 11, 2024 Just Sold Last sold for N/A 5bed 4.5bath 3,...
Texas Fort Bend County Sugar Land Ann Arbor Ct 3110 Ann Arbor Ct View as ownerSeller represented by: Naureen Samad with HomeSmart Buyer represented by: Zain Khan with Goldmount Real Estate Group 1/34 Sold on October 29, 2024 Just Sold Last sold for N/A 4bed 3.5bath 3,084sqft3,084 s...
DNA-protein complexes were immuno-precipitated using a monoclonal anti-HA antibody (Santa Cruz Biotechnology, Texas, USA). Analysis of enrichment of target genes was performed by qPCR (ABI 7500 Fast Real-time PCR System). For PRR7, primer pair 1 was GACGTTTTCCTTACCCACCA (FP), ATTGGCGAGG...
Back Texas Fort Bend County Sugar Land Abercombie Ln 5903 Abercombie Ln View as owner1/41Off Market Interested in selling your home? Estimated home value* $1,296,190 *Estimation is calculated based on tax assessment records, recent sale prices of comparable properties, and other factors. ...
Back Texas Fort Bend County Sugar Land Sweetwater Ct 24 Sweetwater Ct View as owner1/36Off Market Interested in selling your home? Estimated home value* $556,800 *Estimation is calculated based on tax assessment records, recent sale prices of comparable properties, and other factors. 3bed 2.5...
Texas Fort Bend County Sugar Land Menlo Park Dr 4918 Menlo Park Dr View as ownerSeller represented by: Kristen Manz with Exp Realty LLC Buyer represented by: Non-MLS Agent with Houston Assn Of Realtors 1/27 Sold on August 15, 2024 Just Sold Last sold for N/A 5bed 3.5bath 5,102sqf...
Texas Fort Bend County Sugar Land Windwood Ct 7211 Windwood Ct View as owner1/11 Off Market Interested in selling your home? Estimated home value* $406,000 *Estimation is calculated based on tax assessment records, recent sale prices of comparable properties, and other factors. 2bed 2.5bath...
Texas Fort Bend County Sugar Land Dixie Ct 4819 Dixie Ct View as ownerSeller represented by: BRAD HAMMOND with Better Homes and Gardens Real Estate Gary Greene - Sugar Land Buyer represented by: Fabian Martinez with Coldwell Banker Realty 1/37 Sold on August 14, 2024 Just Sold Last sold ...