For fresh alcohol samples we amplified the COI fragment using primers “PatDyt” (TCATTGCACTAATCTGCCATATTAG; Isambert et al. 2011) and “Jerry” (CAACATTTATTTTGATTTTTTGG; Simon et al. 1994). When older material was used we attempted to amplify DNA in two or three overlapping fragments...
35. Shewry, P.R.; Halford, N.G.; Lafiandra, D. The genetics of wheat gluten proteins. Adv. Genet. 2003, 43, 111–184. 36. Sodkiewicz, W. Sprouting resistance and Hagberg falling number values in introgressive Triticale/T. monococcum lines. Biol. Plant. 1999, 42, 533–539. 37....