any gear bag, first aid kit or bug out bag. Snake Bite Kit Comes In A Compact Convenient Carrying Capsule. Two large high suction cups for multiple bites. One small high suction cup for small surfaces. East-to-use lymph constrictor. Scalpel. Antiseptic swab and complete instructions included...
A 22-year old man was bitten by a snake on his scrotum. This interesting and unusual case occurred in the rural area of District Aligarh, India. The uniqueness of the case lies in the fact that scrotum is an extremely rare and unusual site for snake bite
INTRODUCTION: Snake bites are a silent public health problem in Kenya. Previous studies on snake bites in the country have mainly focused on identifying offending snake species, assessing the severity of envenomation and testing the efficacy of antivenom
Proteins constitute almost 95% of snake venom’s dry weight and are produced and released by venom glands in a solubilized form during a snake bite. These proteins are responsible for inducing several pharmacological effects aiming to immobilize and initiate the pre-digestion of the prey. This stu...
We have recently promoted the corn snake Pantherophis guttatus as particularly appropriate for evolutionary developmental studies12,13,14 because of multiple practical parameters: corn snakes are oviparous, easy to breed and harmless (small, non-venomous and reluctant to bite). The corn snake is also...
Viperid snake venoms contain a unique family of cytotoxic proteins, the Lys49 PLA2 homologs, which are devoid of enzymatic activity but disrupt the integrity of cell membranes. They are known to induce skeletal muscle damage and are therefore named ‘myo
We have recently promoted the corn snake Pantherophis guttatus as particularly appropriate for evo- lutionary developmental studies12–14 because of multiple practical parameters: corn snakes are oviparous, easy to breed, and harmless (small, non-venomous, and reluctant to bite). The corn snake is...
However, a pharmacokinetic analysis of antivenom against widow spider bite revealed that, when the i.m. route was employed, it remained unde- tectable in the blood for at least 5 h post-therapy, while measurable concentrations in the systemic circulation were achieved already 30 min after ...
, South Australia). Venom was dissolved in MilliQ water and stored at −20 °C until required. Protein quantification of the venom, fractions and toxins was carried out using a BCA Protein Assay Kit (Thermo Fisher Scientific, Rockford, IL, USA), as per the manufacturer’s instructions....
The gene of Atr-III was amplified with the kit Master Mix Platinum®Taq DNA Polymerase (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. The external primers MpIIIF: 5′gaactcagattggcttgaagga3′ and MpIIIR: 5′ggaagtagctacatcttggaaagcc3′(kindly provided by ...