Aerosol transmission of COVID-19 is the subject of ongoing policy debate. Characterizing aerosol produced by people with COVID-19 is critical to understanding the role of aerosols in transmission. Objective We investigated the presence of virus in size-fractioned aerosols from six COVID-19 patients...
Infectious diseases are caused by pathogenic microorganisms, such as bacteria, viruses, parasites, or fungi. Diseases can be spread, directly or indirectly, from one person to another. Zoonotic diseases are infectious diseases of animals that can cause disease when transmitted to humans. Recently, th...
ELP (MW = 17,000 g/mol; [VPGVG]40) was produced from genetically modifiedE. coliBLR (DE3) bacteria (Novagen EMD), and purification was accomplished through an inverse phase transition procedure involving cycles of solubilization at 4 °C and precipitation at 40 °C. Our lab has publis...
adeno-associated virus (aav) (1) adenovirus (8) all species (24) alligator (6) amphibian (46) armenian hamster (1) avian (33) baboon (32) baboon (negative) (3) bacteria (121) bacterial (4) bat (8) bovine (1003) bovine (negative) (23) c. botulinum (11) c. difficile (1) c....
Forward primer for production of dsRNA against C27D9.1 using L4440 feeding vector in HT115 bacteria:tcagcaaccagcacattctc https://www.sourcebioscience.com/products/life-science-research/clones/rnai-resources/c-elegans-rnai-collection-ahringer/ SourceBioscience LocationII-4A13 Reverse primer for producti...
Our flow cytometry analysis revealed at least three viral groups (referred to as virus-like particles 1, 2, and 3) that exhibited distinctive dynamics suggestive of different host types. Phage-induced bacterial mortality varied between 6.1% (June) and 33.2% (October) in Lake Bourget and between...
This paper uses a mathematical model of fluorescent biological particles composed of bacteria and/or proteins (mostly as in Hill et al., 2013 [23]) to investigate the size-dependence of the total fluorescence emitted in all directions. The model applies to particles which have negligible reabsorpt...
As these vaccines do not contain any live bacteria or viruses, they cannot spread the diseases they are intended to prevent, even in those with highly compromised immune systems, which is one of the major advantages of this type of vaccine. These vaccines do not produce or confer immunity as...
The potential for viral lysis of marine bacteria in seawater enriched with the virus size fraction from seawater was investigated in seawater samples from Long Island Sound, the E Pacific Ocean and the Caribbean Sea. A dominant bacterial mortality agent in the seawater concentrate was bacteriophage,...
Vaccines are comprised of viruses, bacteria, or other disease-causing organisms that have been killed or altered so that they cannot cause any disease, thus, boosting immunity. New advanced vaccines have been manufactured containing genetically engineered components derived from those disease agents. ...