The following primers were used for PCR genotyping to confirm crosses: Tnt1-F, GCATTCAAACTAGAAGACAGTGCTACC and Tnt1-R, TGTAGCACCGAGATACGGTAATTAACAAGA [34] (Tnt1, Genbank:X13777). MtIRE-like specific primers [36] (MtIRE-like, Genbank:AY770392, Genbank:AC122727) were used as a con...
Population transfer by stimulated Raman scattering with delayed pulses: the concept, some problems, and experimental demonstration We discuss recent progress in the attempt to gain complete control over the internal state population of atoms and molecules for collision dynamic studies ... K Bergmann,CY...
As we used the conventional PRM settings for targeted analysis of proteins: 60,000 resolution, 80 ms injection time, isolation width m/z value of 1.6 and 3 × 106 AGC target value, we could not detect the majority of the proteins involved in the UPR (Supplementary Fig. S2A). ...
delayed-stream "~1.0.0" commander@^4.0.0: version "4.1.1" resolved "https://registry.yarnpkg.com/commander/-/commander-4.1.1.tgz#9fd602bd936294e9e9ef46a3f4d6964044b18068" integrity sha512-NOKm8xhkzAjzFx8B2v5OAHT+u5pRQc2UCa2Vq9jYL/31o2wi9mxBA7LIFs3sV5VSC49z6pEhfbMULvShKj26...
fTohree,raefmoriex,tuarme oixftcuhrleorooffochrmlo,roetfhoarmno,le(t9h6a%n)o,la(n9d6%gl)a, cainaldagcelaticciaalcaidceitnica avcoidluimn ea vraotliuomoef r5a:t4io:0o.0f35:w4:a0s.03chwoasesnchaossetnheasmthoebimleobpihleaspeh. aAsen. AexneemxpemlarpylaTryLCTLdCednesintosigtor...
antioxidants Article Amelioration of the Oxidative Stress Generated by Simple or Combined Abiotic Stress through the K+ and Ca2+ Supplementation in Tomato Plants María García-Martí 1,2,†, María Carmen Piñero 1,†, Francisco García-Sanchez 1 , Teresa C. Mestre 1, María López-Dela...
applied sciences Article Discrete Element Simple Shear Test Considering Particle Shape Houying Zhu 1,2, Xuefeng Li 1,2,* , Longlong Lv 1 and Qi Yuan 1,2 1 School of Civil and Hydraulic Engineering, Ningxia University, Yinchuan 750021, China 2 Solid Mechanics Institute, Ningxia University, ...