Materials Science A range of biomedical materials, electronic materials and energy materials to meet your range of materials science needs. Molecular Biology & Functional Genomics From gene editing, DNA and RNA, oligos, qPCR to protein expression, detection, and quantification, our comprehensive offering...
Oligos, qPCR Probes & Peptides Description General description MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.For additional de...
MilliporeSigma’s molecular materials portfolio includes custom and predesigned DNA oligos and probes for a variety of applications such as PCR, next generation sequencing and microarray production. MilliporeSigma is continuing to invest in mRNA as a modality and will scal...
Table 2. Oligos used in the study Ref NoDescriptionSequence (5′ – 3′) STL-324 sigA gene forward with NdeI site CACCCAT ATGGCAGCGACCAAAGCAAG STL-325 sigA gene reverse with HindIII site AGCTAAG CTTAGTCCAGGTAGTCGCGCAG STL-320 sigA-AES 5′ flank forward- DraIII & HpaI site CACCTTTTCA...
oligonucleotides, RNA and DNA extraction from both polyacrylamide and agarose gels. Efficientextraction (>90%) is achieved for 15 nt oligos and for up to 80 kbp DNA fragments. 特点和优势 Easy-to-handle dialyzers for buffer exchange and removal of urea, detergents ...
In addition, D-Tube Dialyzers can be used for oligonucleotides, RNA and DNA extraction from both polyacrylamide and agarose gels. Efficientextraction (>90%) is achieved for 15 nt oligos and for up to 80 kbp DNA fragments. 特点和优势Easy-to-handle dialyzers for buffer exchange and removal ...
Oligos, qPCR Probes & Peptides Description General description MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.For additional de...
CXORF40A(541578) , AC016940.7-202(91966) Related Categories Oligos, qPCR Probes & Peptides Description General description MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to hi...
In that the peptides or oligos are bound to the C18 matrix and eluted after washing, buffer salts would be removed from the sample as part of the wash process. Please see the following link to review additional information, including protocols, for the ZipTip products:https://maestro.file....
NDUFAF2(91942) , NDUFAF2(91942) Related Categories Oligos, qPCR Probes & Peptides Description General description MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-spe...