Upon receiving your documents, SHOPLINE will promptly assist you in completing the subsequent application steps. *Note:The bank account details in the Direct Debit Authorization Form must match the company or individual merchant name selected in the application form. If there are errors or incomplete ...
Thanks to the customizedRaise Flag for SupervisorAgent Action instructions, a supervisor sees a flagged conversation with a customer who mentioned a competitor’s name. After looking into the live transcript, the supervisor notices the customer’s interest in switching services. Recognizing the importanc...
Follow these instructions unless otherwise instructed by your dental professional: 1. Adults and pediatric patients 6 years of age or older, apply a thin ribbon of SF 5000 Plus to a toothbrush. Brush thoroughly once daily for two minutes, preferably at bedtime. 2. After use, adults expectorate...
Resources Terms and Conditions for Using the SF-36 MOS 36-Item Short Form Survey Instrument (SF-36)(English PDF) MOS 36-Item Short Form Survey Instrument (SF-36)(Arabic PDF) Scoring Instructions for MOS 36-Item Short Form Survey Instrument (SF-36) Choose one option for each questionnaire ...
The cDNA was prepared using 100 ng total RNA, oligo dT primers, and the Transcriptor first strand cDNA synthesis kit according to the manufacturer’s instructions (Roche, Indianapolis, IN). Amplification of 5′ and 3′ β-Actin targets were performed using the KAPA SYBR Fast Master Mix (...
We read every piece of feedback, and take your input very seriously. Include my email address so I can be contacted Cancel Submit feedback Saved searches Use saved searches to filter your results more quickly Cancel Create saved search Sign in Sign up Reseting focus {...
μl of sterile water and cDNA was prepared following the kit's instructions. The optional second round of cDNA systhesis was omitted but the cDNA was cleaned using the pheno/chlorform extraction step and ethanol precipitation. The cDNA pellet was resuspended in 30 μl of TE for use in PCR...
PCR was performed on complementary DNA prepared using the High Capacity Reverse Transcription Kit from Applied Biosystems, according to the manufacturer's instructions. Primer sequences for mouse TNFSF14 were: Fwd: ATAGTAGCTCATCTGCCAGATGGA; Rev: CGACTGACCAGCAGTTCTAACT. Measurements of airway ...
312 2 0.636942675159236 postgresql postgresql-9.4.4/src/backend/snowball/libstemmer/stem_ISO_8859_1_danish.c 310 2 0.641025641025641 python Python-2.7.10/Mac/Modules/res/_Resmodule.c 1621 12 0.734843845682792 python Python-2.7.10/Mac/Modules/drag/_Dragmodule.c 1046 8 0.759013282732448 python Python...
According to the instructions, the reagent (1 × 1011VG of Vector-AAV or sFgl2-AAV) was resuspended with 250 μL of normal saline and then injected into the mouse tail vein using an insulin syringe (1/2 mL). 4.4. Bone Marrow Transplantation All ApoE-/- and sFgl2TgApoE-/- mice were...