Self-Targeting Guide RNAs in CRISPR SystemCRISPR/Cas9 methods are provided where a guide RNA is engineered to self-target and inactivate a nucleic acid encoding the guide RNA itself.George M. ChurchReza KalhorPrashant G. Mali
As an important part of the immune system, T lymphocytes exhibit undoubtedly an important role in targeting and eradicating cancer. However, despite these characteristics, their natural antitumor response may be insufficient. Numerous clinical trials in
GA is a terpenoid active ingredient with natural hepatoprotective properties and demonstrating remarkable anticancer activity [83]. The rationale behind the hepatic targeting of GA lies in its receptors being expressed on the surface of mammalian hepatocytes, with its presence on liver tumors being 1.5-...
The discovery of CRISPR-Cas systems has paved the way for advanced gene editing tools. However, traditional Cas discovery methods relying on sequence similarity may miss distant homologs and aren’t suitable for functional recognition. With protein large language models (LLMs) evolving, there is pot...
targeting late genes13,15,16,17. In some type III CRISPR-Cas systems, cOA signaling is terminated by standalone CARF domain-containing ring nucleases, proteins able to degrade cA4 to yield linear adenosine tetra- and dinucleotides18. Furthermore, recent studies have shown that some Csm6-family...
Although the most intuitive form of phage defense involves the direct rescue of an infected cell, for example, by targeted degradation of phage nucleic acids by CRISPR-Cas or restriction modification systems, many phage-defense systems function solely at the population level. In a mechanism conceptua...
Allele-specific CRISPR-Cas9 editing of dominant epidermolysis bullosa simplex in human epidermal stem cells. Mol Ther. 2024;32(2):372–83. Article CAS PubMed Google Scholar Schröder R, Kunz WS, Rouan F, Pfendner E, Tolksdorf K, Kappes-Horn K, et al. Disorganization of the Desmin ...
3. Targeting leukemia stem cells for improved clinical outcomes Intensive, cytotoxic chemotherapy remains the standard of care in treating T-ALL and effectively eliminates proliferating cells. However, these therapies often target the bulk of leukemia cells indiscriminately, which can result in a dramatic...
constructed a multistage delivery NP (MDNP) with a core-shell structure for enhancing tumor targeting of the CRISPR/dCas9 system (Fig. 11d) [164]. When MDNP was transported in the bloodstream and reaches the acidic microenvironment of tumor tissues, the DMMA groups in the shell decompose ...
For generating P53 knock out cells using CRISPR-Cas9 technique, single gRNAs targeting TrP53 gene were cloned in pX330-U6-Chimeric_BB-CBh-hSpCas9 and lentiCRISPR v1 vectors (Addgene) as described previously [86,87,88]. sgRNA sequences as follow: CTCTCTACAGATGACTGCCA, GGACGATCTGTTGCTGCCCC...