How do I fix the error code notebook in Rec Room? 1. Check the Rec Room server status The first thing you need to do to fix the error code notebook is to ensure Rec Room is not having server issues. You can determine this by going to Rec Room Inc.DiscordorSubredditpage to check ...
Server issues– At times, this problem might be due to server downtime. In this case, you might get anerror code Notebookin Rec Room or other error codes. Compatibility issues– If your device is not compatible with Rec Room, the game is unlikely to work on it. You need to check the...
Colonies were maintained in their original packaging under red light in a room with an ambient temperature of 74 °F. Bees were fed ad libitum on commercial sugar water (Koppert, 1.9-l bag per colony). All bees used for this dataset were 10 d old (10 d after eclosion). For ...
The collected FNA sample was placed into a 1.5 ml vial of RNAlater (Invitrogen, Cat. No. AM7022) at room temperature for up to one hour, then stored frozen at -80°C until use. The RNA was extracted using PicoPure RNA isolation kit (ThermoFisher Scientific, Cat. No. KIT0214) and...
sgRNA was formed by adding tracrRNA (IDT cat# 1072533) and crRNA (TP53 exon 2, positive strand, AGG PAM site, sequence: GATCCACTCACAGTTTCCAT) in a 1:1 molecular ratio together and then heating to 95 °C and then allowing to slowly cool to room temperature over 1 h. Cas9RNP was...
with the supervising researcher present in an adjacent room. The supervision was provided via a video call to replicate the fully remote setting of the first variant. For this, the researcher stayed in a separate room. The reason for this second variant was mainly to speed up the data collect...
All secondary antibodies were added at 1:300 for 1 h in room temperature. Cell nuclei were stained with 20 μg/ml DAPI (4′,6-Diamidino-2- Phenylindole, Invitrogen) in PBS for 15 min. High-throughput imaging was done with an automated spinning disk microscope from Yokogawa (Cell...
BABB clearing and TO-PRO®-3 staining were performed as follows. Post-fixed hemisphere samples were incubated with 10% (vol/vol) 1,2-hexanediol (TCI, #H0688) in Milli-Q water at room temperature for 1 day. The delipidated samples were then immersed in PBS containing 500 mM NaCl, ...
In the context of segmentation, there exists room for more consistent annotation, as indicated by the MSEGGT quality scores (Fig. 5). Therefore, increasing the consistency of the annotations should improve algorithm performance. Our per-modality look at the correlations confirm the global trend ...