Linear expression templates were amplified via PCR using the pJL1_LET_F (ctgagatacctacagcgtgagc) and pJL1_LET_R (cgtcactcatggtgatttctcacttg) primers in a 50 μL PCR reaction using the Q5 Hot Start DNA polymerase (NEB, M0493L) following manufacturer instructions. The DNA sequence of ...
(γ-proteobacteria) Pasteurella multocida Haemophilus influenzae 86 028NP Haemophilus influenzae Mannheimia succiniciproducens MBEL55E Haemophilus ducreyi 35000HP Other γ-proteobacteria Psychrobacter cryohalolentis K5 Psychrobacter arcticum 273-4 Pseudoalteromonas haloplanktis TAC125 δ-Proteobacteria Desulfovibrio ...
Linear expression templates were amplified via PCR using the pJL1_LET_F (ctgagatacctacagcgtgagc) and pJL1_LET_R (cgtcactcatggtgatttctcacttg) primers in a 50 μL PCR reaction using the Q5 Hot Start DNA poly- merase (NEB, M0493L) following manufacturer instructions. The DNA sequence ...
(h,thic"hirrcs""essTesa"aatr,t"aaeoaao,),rie)*dweaiwnc""h"tac"at"t)oltt)nlann"ei"iei,n,eiid,rn,drerdn"tipsitt"titsdatisdaaidaeattyeteyettaefstietfiitehb"nnhpe"eenfpertaex"rdtacxp"nretepwtclameprwudcaisrdit,istr,aehttrdraisd"trtaitrt"tttrameist"shsahu"i"ihr"ahut"i""fiti...