The Illumina TruSeq Nano workflow (Illumina, 2019), for example, requires ten steps to attach adapters and barcodes to the nucleotides. The bead-based purification steps in particular, which entail the handling of magnets and magnetic particles by the user, are error-prone and can result in ...
A survey of best practices for RNA-seq data analysis. Genome Biol. 2016;17:13. 5. Na W, Lee IJ, Koh I, Kwon M, Song YS, Lee SH. Cancer-specific functional profiling in microsatellite-unstable (MSI) colon and endometrial cancers using combined differentially expressed genes and biclustering...
Sequencing platform was Illumina HiSeq X Ten (San Diego, CA, USA) with sequence length PE150 bp. To evaluate the shortened adapters and redesigned barcodes, we constructed four MiddRAD sub-libraries according to protocol B for 40 offsprings of a D. latiflorus F1 population and sequenced the...
Results We sequenced RNA-seq libraries throughout a developmental timecourse of the nematode Pristionchus pacificus. The transcriptomes reflect early larval stages, adult worms including late larvae, and growth-arrested dauer larvae and allowed the identification of developmentally regulated gene clusters....
Aliteraturesurveyshowedthat2-amino一3一cyano-4一aryl— S.1O.dioxo一5,10一dihydro-4H-benzo 1chromeneshavebeen preparedinthepresenceofDBU[CH3CO0],[Pyrr]【CH3CO0], 【Pyrr儿HCO0],[Pip]【CH3CO0],[Pip][HCO0],【Hmim儿HCO0], and3-HPAA『12],Et3NandCH3CN【13],HOAc/dimethylfor。 mamide ...
coli ET3. For the deletion of dsdA in E. coli ET3, the chloramphenicol resistance from pKD13 was in turn amplified with the following primers: (SEQ ID NO: 7) 5′_GCGGGCACATTCCTGCTGTCATTTATCATCTAAGCGCAAAGAGACGT ACTGTGTAGGCTGGAGCTGCTTC_3′: (SEQ ID NO: 8) 5′_GCAGCATCGCTC...
FIG. 2 shows the measured Tm values for a number of different double-stranded DNA oligomers (y-axis label=d(F)/d(T), x-axis label=Temperature in ° C.). 1 corresponds to the sense template polynucleotide (SEQ ID NO: 40) hybridised to the chemically synthesised antisense strand (SEQ ...
Such method is a method for producing retinal ganglion cells with elongated axons comprising the following steps: (a) a step of inducing pluripotent stem cells to differentiate into retinal progenitor cells via floating culture; (b) a step of inducing the retinal progenitor cells obtained in step...
(SEQ ID No:1); or a chimeric protein comprising part of the amino acid sequence of a canine urate oxidase and part of the amino acid sequence of a human urate oxidase; or a mutant protein thereof. Wherein, the first 240 amino acids at the N-terminus of said chimeric protein may be ...
A pH of 2.1 is preferred for increasing the solubility of some peptides, e.g. amino-oxy-acetyl-YREDGVTPYMIFFKDGLEMEK-OH (SEQ ID NO:2). In addition oximation occurs much faster at pH 2.1 than at pH 4.6. One skilled in the art can determine the pH versus solubility profile of a ...