Tuberculosis (Tb) and HIV infection in the homeless population of San Francisco (SF), CAZolopa, AVranizan, KMeakin, RMoss, A R
Search or jump to... Search code, repositories, users, issues, pull requests... Provide feedback We read every piece of feedback, and take your input very seriously. Include my email address so I can be contacted Cancel Submit feedback Saved searches Use saved searches to filter your...
Smartphone usage is an essential everyday tool in Iran, however problematic use has escalated and become a concern for the Iranian health policy system, particularly during and following the COVID-19 Pandemic. This study’s aim was investigation of the p
MATC GTTTTCTTCGGGCAGTGCATAGTGTA N/A KASP N. Larkan, pers. comm. Abbreviation: DAS, deep amplicon sequencing. a Kompetitive allele-specific PCR (KASP) primer sequences are provided without the fluorescent tag sequence as this is proprietary information of GeneWorks. Information regarding fluore...
Ashby SF (1922) Oospores in cultures of Phytophthora faberi. Kew Bull 1922(9):257–262 Google Scholar Ashu EE, Xu J (2015) The roles of sexual and asexual reproduction in the origin and dissemination of strains causing fungal infectious disease outbreaks. Infect Genet Evol 36:199–209. htt...
36‑item short form health survey (SF‑36) measure This study used the Hungarian version of the SF-36v1 with a four-week recall period [39]. SF-36 is a self-reported generic measure of HRQoL with 35 items that cover eight multi-item health domains, specifically physical functioning (...
The nucleotide diversity of three populations varied significantly (p < 0.05, Kruskal–Wallis Test), with the Sichuan population having the lowest genetic θπ (1.69 × 10–3). Conclusions Genetic diversity of Forest Musk Deer was moderate at the genomic scale compared with other ...
Among six extant tiger subspecies, the South China tiger (Panthera tigris amoyensis) once was widely distributed but is now the rarest one and extinct in the wild. All living South China tigers are descendants of only two male and four female wild-caught
The social stratification of internal migration and daily mobility during the COVID-19 pandemic Introduction As stated by the UN that “[t]here are over 476 million indigenous people living in 90 countries across the world, accounting for 6.2 per cent of the global population. Of those, there...
This cohort study examines the latest expansion of the lung cancer screening eligibility criteria for adults in the US.